Teorija evolucije ili kreacionizma - Strana 2
Strana 2 od 26 PrvaPrva 123412 ... PoslednjaPoslednja
Prikaz rezultata 16 do 30 od ukupno 378
  1. #16

    Odgovor: Teorija evolucije ili kreacionizma

    Ma, da...šta ja znam...ja sam samo "početnik" ... ti si "ser žile"

    pooozzz...


  2. #17

  3. #18

    Odgovor: Teorija evolucije ili kreacionizma

    Ikone evolucije

    "Nauka je traganje za istinom", pisao je hemicar Linus Pauling, dobitnik dve Nobelove nagrade. Brus Alberts (Bruce Alberts), sadasnji predsednik Americke akademije nauka, slaze se: "Nauka i laz ne mogu da koezistiraju", rekao je Alberts u maju 2000. godine, citirajuci izraelskog drzavnika Simona Pereza (Shimon Peres). "Ne postoji naucna laz, i ne mozete naucno da lazete. Nauka je u osnovi traganje za istinom."

    Sta je evolucija? Bioloska evolucija je teorija da su sva ziva bica izmenjeni potomci zajednickog pretka koji je ziveo u dalekoj proslosti. Ona tvrdi da smo vi i ja potomci majmunolikih predaka, a da su oni potekli od jos primitivnijih zivotinja. Za Carlsa Darvina, poreklo sa promenama je bilo poreklo svih zivih bica posle prvih organizama. Kada zastupnici Darvinove teorije odgovaraju na kritike, nekada tvrde da "evolucija" prosto znaci promenu u toku vremena. Ali ovo je ocigledno izvrdavanje. Nijedna racionalna osoba ne negira realnost promene i nije nam bio potreban Carls Darvin da nas u to ubedi. Ako "evolucija" znaci samo to, bila bi apsolutno neosporna. Niko ne veruje da je bioloska evolucija jednostavno samo promena kroz vreme.

    Kada su pitani da nabroje dokaze za Darvinovu evoluciju, vecina ljudi - ukljucujuci vecinu biologa - daje istu grupu primera, zbog toga sto su svi ucili biologiju iz nekoliko istih udzbenika. Najcesci primeri su:
    - laboratorijski sud koji sadrzi smesu koja simulira Zemljinu primitivnu atmosferu, u kojoj elektricne varnice proizvode hemijske gradivne blokove zivih celija;
    - evoluciono drvo, rekonstruisano na osnovu velikog i rastuceg fo-silnog zapisa i molekularnih cinjenica; - slicne strukture kostiju u krilu slepog misa, peraju morskog praseta, nozi konja i ruci coveka koje ukazuju na njihovo evoluciono poreklo od zajednickog pretka;
    - slike slicnosti ranih embriona koje pokazuju da su vodozemci, gmizavci, ptice i ljudska bica, svi potekli od ribolike zivotinje;
    - Archaeopteryx, fosilna ptica sa zubima u svojim vilicama i kandzama na svojim krilima - nedostajuca karika izmedju drevnih gmizavaca i savremenih ptica;
    - leptiri biberastog moljca na stablima drveca pokazuju kako su maskiranje i ptice grabljivice proizvele najcuveniji primer evolucije prirodnom selekcijom;
    - Darvinove zebe na galapagoskim ostrvima - trinaest razlicitih vrsta koje su se odvojile od jedne, kada je prirodna selekcija proizvela razlike u njihovim kljunovima, sto je inspirisalo Darvina da formulise svoju teoriju o evoluciji;
    - vinske musice sa dodatnim parom krila pokazuju da genetske mutacije mogu da proizvedu sirovu gradju za evoluciju;
    - raspored fosilnih konja u obliku razgranatog drveta koji protivreci staromodnoj ideji da je evolucija usmerena; i
    - crtezi majmunolikih stvorenja koji se razvijaju u ljude pokazuju da smo samo zivotinje i da je nase postojanje samo sporedni proizvod besciljnih prirodnih uzroka.

    Ovi primeri se toliko cesto koriste kao dokazi za Darvinovu teoriju da je vecina njih nazvana "ikone" evolucije. Pa ipak, svi oni, na ovaj ili onaj nacin, pogresno predstavljaju istinu. Navescemo neke.


    Hekelovi embrioni


    "Cini mi se", pisao je Darvin u knjizi "Postanak vrsta", "da glavne cinjenice u embriologiji, koje su drugorazredne po vaznosti, objasnjene su na principu varijacija mnogih potomaka od nekog drevnog pretka". Darvin nije bio embriolog, pa se oslanjao za svoje dokaze na radove drugih. Jedan od njih je bio nemacki biolog Ernest Hekel (Ernst Haeckel) (1834-1919). Darvin je pisao u knjizi "Postanak vrsta" da je profesor Hekel "ulozio svoje veliko znanje i sposobnosti da bi proizveo ono sto on naziva filogenija - linije porekla svih organskih bica. U crtanju nekoliko nizova on se oslanjao uglavnom na embrionalne karakteristike."

    Hekel je napravio puno crteza, ali najpoznatiji su oni o ranim embrionima kicmenjaka. Hekel je crtao emrione iz razlicitih klasa kicmenjaka da bi pokazao da su stvarno identicni u svojim najranijim stupnjevima i da postaju primetno razliciti tek kada se razviju (vidi sliku). To je bio onaj obrazac rane slicnosti, a kasnije razlicitosti, koji je Darvin u knjizi "Postanak vrsta" smatrao tako uverlljivim.

    Cini se da Hekelovi embrioni obezbedjuju tako snazan dokaz za Darvinovu teoriju da neka od njihovih verzija moze da se nadje u skoro svakom modernom udzbeniku koji se bavi evolucijom. Pa ipak, biolozi su znali vec vise od jednog veka da je Hekel falsifikovao svoje crteze; embrioni kicmenjaka nikada ne izgledaju toliko slicni koliko ih je on nacinio da to budu. Stavise, stupanj koji je Hekel oznacio kao "prvi", u stvari je sredisnji u toku razvica; slicnostima koje je preuvelicao, pret-hode upadljive razlike u ranijim fazama razvica. Iako biste mogli da to nikad ne saznate citajuci bioloske udzbenike, Darvinova "najaca pojedinacna klasa cinjenica" je klasican primer kako cinjenice mogu da budu izvrnute da odgovaraju teoriji.

    Kada se Hekelovi embrioni pregledaju zajedno sa pravim embrionima, ne moze biti sumnje da su njegovi crtezi namerno izmenjeni da bi odgovarali teoriji (vidi sliku). Pisuci u martu 2000. godine clanak za casopis Naatural History, Stefan Dzej Guld je zabelezio da je Hekel "preuvelicao slicnosti uz pomoc idealizacija i izostavljanja" i zakljucio da se njegovi crtezi karakterisu "netacnostima i direktnim falsifikacijama". Britanski embriolog Majkl Ricardson je, kada je intervjuisan za casopis Science, posto su on i njegovi saradnici objavili njihova danas cuvena poredjenja izmedju Hekelovih crteza i stvarnih embriona, otvoreno rekao: "Izgleda kao da se ispostavlja da je to jedna od najvecih prevara u biologiji."

    Prema tome, Hekelovi crtezi su falsifikati i oni pogresno predstavljaju embrione koje bi trebalo da prikazu. Ali, oni su falsifikati i u drugom smislu. Darvin je zasnovao svoj zakljucak o zajednickom poreklu na verovanju da su najraniji stupnjevi embrionalnog razvica najslicniji. Hekelovi crtezi, ipak, potpuno izostavljaju najranije stupnjeve, i pocinju od sredine razvica. Raniji stupnjevi su veoma razliciti (vidi sliku).

    Posto je Darvinova teorija prihvacena bez obzira na cinjenice, i "ontogenija rekapitulira filogeniju" je logicka dedukcija na osnovu te teorije, bioloski udzbenici nastavljaju da je predaju. Na primer, Hekelovi crtezi su reprodukovani u izdanju iz 1998. godine viseg fakultetskog udzbenika Daglasa Futujame, "Evoluciona biologija". A najnovije izdanje knjige "Uvod u biologiju" (Invitation to Biology), od Helene Kertis (Helena Curtis) i Sju Barns (Sue Barnes), reprodukuju gornja dva reda Hekelovih crteza.

    Hekelovi crtezi se ne pojavljuju samo u Futujaminoj knjizi i knjizi Kertisove i Barnsove, vec i u najnovijem izdanju "Molekularne biologije celije", od predsednika Nacionalne akademije nauka Brusa Albertsa i njegovih saradnika. "Rani razvojni stupnjevi zivotinja ciji odrasli oblici izgledaju veoma razlicito, cesto su iznenadjujuce slicni", tvrdi Albertsov udzbenik, a neo-darvinisticki mehanizmi objasnjavaju zbog cega "embrioni razlicitih vrsta toliko cesto podsecaju jedni na druge na svojim ranim stupnjevima i zasto tokom razvica ponekad izgleda da ponavljaju korake evolucije".

    Februara 2000. godine pisac udzbenika Daglas Futujama poslao je poruku internet forumu Kanzas Sitija kao odgovor kriticaru koji ga je optuzivao za laganje koriscenjem Hekelovih embriona u svom udzbeniku iz 1998. godine, "Evoluciona biologija". U svoju odbanu, Futujama je objasnio da pre citanja optuzbe kriticara nije bio svestan nesaglasnosti izmedju Hekelovih crteza i realnih embriona kicmenjaka. Tek posto je konsultovao razvojnog biologa saznao je o skorasnjem radu Ricardsona i njegovih saradnika.

    Prema tome, Futujama, profesionalni evolucioni biolog i autor udzbenika postdiplomskog nivoa, nije znao o Hekelovim falsifikovanim crtezima - priznanje neznanja za koje nije verovatno da ce da izazove mnogo pouzdanja u kvalitet nasih bioloskih udzbenika. Ali, sada on zna da je "Hekel bio neprecizan i obmanjivacki", i rekao je da ce to uzeti u obzir u buducim izdanjima svoje knjige.

    Medjutim, za razliku od Futujame, Guld je priznao da je vec znao za to; u stvari, znao je za to vise od dvadestet godina. (Kao istoricar nauke, Guld je napisao veliku knjigu o ovom predmetu 1977. godine, "Ontogenija i filogenija" (Ontogeny and Phylogeny).) Optuzivao je skorasnje izvestaje za pravljenje senzacije od te price dajuci utisak "da je Ricardson prvi otkrio Hekelovo necasno delo". Guld je nastavio: "Price o prevarama u nauci uzbudjuju mastu sa dobrim razlogom. Provuci se sa akademskim ekvivalentom ubistva, a onda biti otkriven vek posle svojih nedela, cini pricu jos boljom."

    Ali, ako su biolozi od pocetka znali da su Hekelovi crtezi falsifikovani, zasto se onda oni jos uvek koriste? Guld je svalio krivicu na pisce udzbenika, optuzujuci ih za pojednostavljanje njihovog predmeta do te mere da ga ucine netacnim. "Mislim da imamo prava", pisao je, "da budemo i zaprepasteni i postidjeni stoletnim nepromisljenim recikliranjem koje je dovelo do opstanka ovih crteza u velikom broju, ako ne i u vecini, savremenih udzbenika".

    Prema tome, Guld okrivljuje pisca udzbenika, dok se pisac udzbenika pravda neznanjem. Medjutim, obojica su brzi kada treba da kritikuju zastupnike stvaranja. "Zapazite da je nauka samoispravljajuci proces", napisao je Futujama kao odgovor svom kriticaru iz Kanzasa, "za razliku od kritika nauke koju iznose zastupnici stvaranja; evolucioni biolozi sami otkrivaju nepravilnosti u ranijoj literaturi iz svoje oblasti". A Guld optuzuje zastupnike stvaranja za prenaglasavanje rada Ricardsona i njegovih saradnika praveci "surogatne" i "senzacionalisticke" napade da je "osnovni stub Darvinizma, i evolucije uopste, otkriven kao pogresan posle vise od veka" nekritickog prihvatanja.

    Ali Futujama je bio taj koji je nepromisljeno reciklirao Hekelove embrione u nekoliko izdanja svog udzbenika, dok ga jedan zastupnik stvaranja nije kritikovao zbog toga. A Guld je bio taj koji je (uprkos tome sto je znao istinu vise od dvadeset godina) cutao dok jedan zastupnik stvaranja (u stvari, kolega biolog) nije izlozio problem. A za svo to vreme Guld je pustao svoje kolege da postaju saucesnici u onome sto on sam naziva "akademskim ekvivalentom ubistva".


    Archaeopteryx: karika koja nedostaje


    Kada je Carls Darvin objavio knjigu "Postanak vrsta" 1859. godine, priznao je da fosilni zapis pretstavlja ozbiljan problem za njegovu teoriju. "Prema teoriji prirodnog odabiranja", pisao je, "sve zive vrste su bile povezane sa roditeljskom vrstom svakog roda, sa razlikama ne vecim od onih koje danas vidimo izmedju prirodnih i domacih varijeteta iste vrste". Kao posledica toga, "broj posrednih i prelaznih formi, izmedju svih zivih i izumrlih vrsta, mora da je bio neshvatljivo velik". Ipak, 1859. godine te prelazne forme nisu bili nadjene. Darvin je pripisao njihovo odsustvo "neocuvanosti fosilnog zapisa". Tvrdio je da vecina organizama nikada nije bila sacuvana, ili ako je sacuvana, bila je kasnije unistena, tako da "ne mozemo da ocekujemo da nadjemo u nasim geoloskim formacijama beskonacan broj tih prelaznih forme koje su, po nasoj teoriji, povezivale sve prosle i sadasnje vrste iste grupe u dugacak i razgranat lanac zivota. Trebalo bi da trazimo samo nekoliko veza".

    Dve godine kasnije, usred zestokog spora oko Darvinove teorije, dosla je dramaticna objava da je jedna od tih veza pronadjena. Godine 1861., Herman fon Mejer (Hermann von Meyer) opisao je fosil za koji je izgledalo da je prelazna forma izmedju gmizavaca i ptica. Otkriven u nalazistu krecnjaka u Solenhofenu, u Nemackoj, fosil je imao krila i perje; ali je takodje imao zube (koje nema nijedna savremena ptica), dugacak rep nalik gusterskom i kandze na svojim krilima. Mejer je nazvao novootkrivenu zivotinju Archaeopteryx (sto znaci "drevno krilo").

    Godine 1877., pronadjen je jedan jos ocuvaniji primerak roda Archaeopteryx. Prvi primerak je smesten u Prirodnjackom muzeju u Londonu (i danas je poznat kao "Londonski primerak"), dok je drugi smesten u Humboltovom muzeju u Berlinu ("Berlinski primerak") (vidi sliku). Nadjeno je jos sest drugih primeraka, sto zajedno cini osam (iako jedan predstavlja samo jedno pero, a jedan je izgubljen). Ali, berlinski Archaeopteryx je najkompletniji i najbolje ocuvan, i postao je poznat milionima ljudi kao karika koja nedostaje, koja je potvrdila Darvinovu teoriju.

    Ipak, uloga roda Archaeopteryx kao veze izmedju gmizavaca i ptica veoma je sporna. Paleontolozi se sada slazu da Archaeopteryx nije predak savremenih ptica, a njegovi preci su predmet jedne od najzescih raspravi u savremenoj nauci. Karika koja nedostaje izgleda da jos uvek nedostaje.

    Evolucija ptica od ne-letecih predaka ne bi bila jednostavna stvar, zato sto sposobnost letenja zahteva velike promene zivotinjske anatomije i fiziologije. Postoje dve vazece teorije o tome kako je mogla da nastane sposobnost letenja: teorija "sa drveca na dole", i teorija "sa zemlje navise". Po prvoj, preci ptica su poceli svoje evoluciono putovanje skacuci sa drveca, postepeno akumulirajuci male adaptacije koje su produzavale njihovu sposobnost lebdenja i jedrenja. Po drugoj, male zivotinje su trceci za plenom po zemlji postepeno akumulirale male adaptacije koje su povecavale njihove sposobnosti dosezanja i skakanja. U obe teorije, krajnji korak je sticanje krila i sposobnosti za pravo lete-nje njihovim mahanjem.

    Na prvi pogled, teorija "sa drveca na dole" mogla bi da izgleda verovatnija. Ali, jedan relativno nov metod za analiziranje fosila - zasnovan na strogoj primeni Darvinove teorije - postao je prilicno popularan zadnjih godina. Taj novi metod zove se "kladistika" (od grcke reci koja znaci "grana"), i on vodi do zakljucka da su preci roda Archaeopteryx bili dvonozni dinosaurusi.

    Geolog amater Carls Douson (Charles Dawson) i Britanski muzej objavili su 1912. godine otkrice blizu mesta Piltdaun, u Engleskoj - navodnu nedostajucu kariku izmedju majmuna i ljudi. Primerak je bio izlozen u Britanskom muzeju sve dok nije utvrdjeno da je lazan, 1953. godine. Neko je spojio staru ljudsku lobanju sa donjom vilicom savremenog orangutana, koja je obradjena da izgleda kao deo iste jedinke. "Piltdaunski covek" ostaje najpoznatija fosilna prevara u istoriji nauke.

    Godine 1999., jedan amater, ljubitelj dinosaurusa, Stefan Cerkas (Stephen Cserkas) i Nacionalno geografsko udruzenje objavili su da je fosil koji je bio kupljen za 80.000 dolara na jednoj izlozbi minerala u Arizoni bio "nedostajuca karika izmedju kopnenih dinosaurusa i ptica, i da je mogao stvarno da leti". Fosil, koji je izgleda prokrijumcaren iz Kine, imao je prednje udove primitivne ptice i rep dinosaurusa. Cerkas ga je nazvao Archaeoraptor.

    U novembru 1999. godine u casopisu National Geographic prikazan je Archaeoraptor u clanku naslovljenom "Perje za Ti-reksa?" Kristofer Sloun (Christofer Sloan), autor clanka, tvrdio je da sada mozemo da kazemo da su ptice dinosaurusi "isto tako sigurno kao sto mozemo da kazemo da su ljudi sisari", i da su pernati dinosaurusi prethodili prvoj ptici. Clanak prikazuje crtez malog tiranosaurusa sa perjem - otuda njegov naslov. On takodje prikazuje sliku fosila roda Archaeoraptor, objasnjavajuci da je njegova kombinacija "naprednih i primitivnih karakteristika upravo ono sto bi naucnici ocekivali da pronadju kod dinosaurusa koji eksperimentisu sa letom".

    Ispostavilo se da je Archaeoraptor imao tacno one karakteristike koje su naucnici ocekivali da pronadju zato sto ih je bistri falsifikator ucinio takvim, znajuci da ce to doneti velike pare na medjunarodnom trzistu fosila. Falsifikovanje je otkrio kineski paleontolog Ksu Ksing (Xu Xing), koji je dokazao da se primerak sastojao od repa dinosaurusa nalepljenog na telo primitivne ptice.

    Stors Olson (Storrs Olson), nadzornik za ptice na Smitsonian Institutu u Vasingtonu, poslao je ljutito pismo Piteru Rejvenu, sekretaru Nacionalnog geografskog udruzenja. Olson je optuzivao Udruzenje za saradnju sa "grupom fanaticnih naucnika" koji su postali "otvoreni i veoma pristrasni propovednici vere" da su se ptice razvile od dinosaurusa. "Istina i pazljivo naucno odmeravanje cinjenica bile su medju prvim zrtvama u njihovom programu", pisao je Olson, "koji brzo postaje jedna od vecih naucnih prevara naseg doba". Casopis National Geographic poslao je delimicno poricanje 21. ja-nuara 2000. godine, na svoj veb sajt na internetu. Ipak, casopis je zestoko kritikovan u februaru od strane casopisa Nature za "naivno i ishitreno objavljivanje clanka - opisanog kao senzacionalisticko, neosnovano, tabloidno novinarstvo od strane vodeceg paleontologa - punog sum-njivih tvrdjenja".

    Incident je bio stvarno neprijatan za casopis National Geographic, koji je pokusao da primiri stvar objavljivanjem pisma Ksu Ksinga o prevari u martu 2000. godine. Za to vreme, urednik casopisa je objavio protest u uvodniku casopisa Nature, tvrdeci da je "primenljiva informacija o integritetu primerka" bila uskracena casopisu National Geographic i naucnicima koje je platio da prouce fosil.

    Optuzbe i kontra optuzbe nastavljaju da se izbacaju. Neki ljudi ukljuceni u skandal okrivljuju medjunarodnu trgovinu krijumcarenim fosilima, dok drugi okrivljuju uobrazeno novinarstvo. Ali, izgleda da je pravi krivac kladisticka zelja da dokazu svoju teoriju. Kao sto je potreba za nedostajucom karikom izmedju majmuna i ljudi dovela do Piltdaunskog coveka, tako je i potreba za nedostajucom vezom izmedju dinosaurusa i ptica poplocala put za "Piltdaunsku pticu". Nestala u metezu, bila je cinjenica da cak i da je Archaeoraptor bio pravi, bio je desetine miliona godina mladji, prema evolucionom racunanju vremena, od roda Archaeopteryx, i tako ne bi uspeo da zapusi rupu ostavljenu u fosilnom zapisu kladistickom metodologijom.

    U aprilu 2000. godine, Cerkas i ugledni kladisti - zajedno sa nekim njihovim kriticarima - okupili su se u Fort Loderdejlu, u Floridi, na Simpozijumu o evoluciji ptica dinosaurusa. Ja sam takodje prisustvovao, da bih slusao o sporu. Iako su se neki plasili da ce neprijatna epizoda Archaeoraptor dominirati konferencijom, prevara je bila uveliko ignorisana. Na njegovom mestu, kladisti su predstavili novu zvezdu, najavljenu kao dosada najbolju nedostajucu kariku.

    Novo otkrice koje je na pozornici zamenilo prevaru Archaeoraptor, bio je Bambiraptor, koga je prvobitno otkrila jedna porodica iz Montane 1993. godine i predala profesionalnim paleontolozima 1995. godine. Telo zivotinje je bilo otprilike velicine kokoske, ali je njen dugacak rep bio dug oko jedan metar. Sa ostrim zubima i kandzama, podsecao je na malog Velociraptora - nemilosrdnog predatora koji je postao cuven iz zavrsnih scena filma "Park iz doba jure".

    Svakom ucesniku konferencije data je kopija clanka koji je sadrzao zvanicni naucni opis roda Bambiraptor, objavljen samo tri nedelje ranije. Prvi objavljeni izvestaj o novootkrivenoj fosilnoj vrsti trebao bi da bude sastavljen u skladu sa najvisim naucnim standardima, opisujuci "tip" primerka sa savesnim obaziranjem na preciznost. Zvanicni opis roda Bambiraptor sadrzi nekoliko crteza rekonstruisane zivotinje, od kojih dva pokazuju izrastaje na telu nalik dlakama i perje na prednjim udovima.

    Ali nista sto imalo podseca na perje nije nadjeno sa fosilom. Izrastaji nalik dlakama i perje su imaginarni. Zato sto kladisticka teorija kaze da treba da su tu, ukljuceni su u naucni opis fosila. Jedina indikacija da izrastaji i perje nisu stvarni jeste naslov slike koji ukljucuje recenicu: "Rekonstrukcija prikazuje pretpostavljene kozne strukture."

    Bilo je nekoliko otvorenih kriticara teorije o dino-pticama na simpozijumu u Floridi. Jedan je bio ornitolog sa Univerziteta Severna Karolina, Alan Feducija, koji je predvideo da ce se ispostaviti da je teorija o dino-pticama "najveca sramota paleontologije dvadesetog veka". Drugi je bio Leri Martin (Larry Martin), koji je rekao da kada bi morao da brani teoriju o dino-pticama, "bilo bi mi neprijatno svaki put kada bi morao da ustajem i pricam o tome". A Stors Olson je narogusio neke zastupnike dino-pera deleci bedzeve na kojima je pisalo "Ptice NISU dinosaurusi".

    Drugog dana simpozijuma, Vilijam Garstka (William Garstka) izvestio je da su on i tim molekularnih biologa iz Alabame izolovali DNK iz fosilnih kostiju dinosaurusa navodno starog 65 miliona godina. Iako cinjenice iz drugih istrazivanja ukazuju da DNK starija od oko milion godina ne moze da pruzi bilo kakvu upotrebljivu informaciju o sekvenci, Garstka i njegovi saradnici su umnozili i sekvencirali DNK, uporedili je sa svim poznatim DNK iz drugih zivotinja, i pronasli da je najslicnija pticjoj DNK. Zakljucili su da su pronasli "prve direktne geneticke cinjenice koje ukazuju da ptice predstavljaju najblize zive srodnike dinosaurusima". Njihov zakljucak je sledece nedelje objavila Konstanca Holden (Constance Holden) u casopisu Science.

    Medjutim, detalji ovog otkrica se otkrivaju. Prvo, dinosaurus iz koga su Garstka i njegovi saradnici navodno izolovali DNK bio je Triceratops. Po paleontolozima, postoje dve glavne grane porodicnog stabla dinosaurusa. Jedna grana ukljucuje trorogog dinosaurusa roda Triceratops, koji je nalik nosorogu i koga su milioni ljudi videli u muzej-skim izlozbama i filmovima. Ali, za ptice se pretpostavlja da su se razvile iz druge grane. Prema tome, prema evolucionim biolozima, Triceratops i savremene ptice nisu blisko srodne, posto su njihovi preci navodno krenuli odvojenim putevima pre skoro 250 miliona godina.

    Medjutim, ono sto je jos vaznije jeste da je DNK koju su Garstka i njegovi saradnici pronasli bila 100% identicna sa DNK zivih curki. Ne 99%, ne 99,9%, vec 100%. Cak ni DNK dobijena iz drugih ptica nije 100% identicna sa DNK curki (drugo najblize poklapanje u njihovoj studiji je bilo 94,5% sa jednom drugom vrstom ptica). Drugim recima, DNK koja je navodno izolovana iz kostiju roda Triceratops nije bila samo slicna sa DNK curke - to jeste bila DNK curke. Garstka je rekao da su on i njegovi saradnici razmatrali mogucnost da je neko jeo u blizini sendvic sa curetinom, ali nisu mogli to da potvrde.


    Biberasti moljci


    Darvin je bio ubedjen da je u toku evolucije "prirodno odabiranje bilo najznacajnije, ali ne i iskljucivo sredstvo promene", ali nije imao direktne dokaze prirodnog odabiranja. Bilo je obilje dokaza da biljke i zivotinje variraju i da se bore za opstanak. Bilo je razumljivo zakljuciti, po analogiji sa domacim gajenjem, da bi organizmi sa najkorisnijim varijacijama preziveli i preneli te varijacije na svoje potomke. Ali niko nije stvarno dokumentovao taj proces u divljini. Najbolje sto je Darvin mogao da uradi u knjizi "Postanak vrsta" bilo je da "ponudi jedan ili dva zamisljena primera".

    Britanski naucnici su uocili fenomen koji ce vremenom postati klasicni udzbenicki primer prirodnog odabiranja na delu. Vecina biberastih moljaca bila je svetle boje pocetkom devetnaestog veka, ali su za vreme industrijske re-volucije u Britaniji populacije ovih moljaca, blizu veoma zagadjenih gradova, postale uglavnom "melanicne" ili tamno obojene. Fenomen je nazvan "industrijski melanizam", ali su njegovi uzroci ostali stvar spekulacije do ranih 1950-tih, kada je britanski lekar i biolog Bernard Ketlevel (Bernard Kettlewell) izveo neke eksperimente koji su ga ucinili slavnim. Ketlevelovi eksperimenti su nagovestavali da su grabljive ptice jele svetlo obojene moljce kada su postali upadljiviji na stablima drveca potamnelim usled zagadjenja, ostavljajuci tamniji varijetet da prezivi i da se razmnozava. Izgledalo je da je industrijski melanizam biberastih moljaca primer prirodnog odabiranja.

    Ketlevel je nazvao industrijski melanizam kod biberastih moljaca "najupecatljivijom evolucionom promenom ikad stvarno posvedocenom kod bilo kog organizma". Posto je izgledalo da njihovi eksperimenti obezbedjuju empirijsku potvrdu prirodnog odabiranja, Ketlevel je nazvao svoje rezultate kao "Darvinov nedostajuci dokaz", u clanku pisanom za casopis Scientific American.

    Godine 1975., britanski geneticar P. M. Separd (P. M. Sheppard) nazvao je ovaj fenomen "najupecatljivijom evolucionom promenom koju su ljudi ikad uocili i zabelezili, sa mogucim izuzetkom nekih primera otpornosti na pesticide", a proslavljeni evolucioni biolog Seval Vrajt nazvao ga je "jasnim slucajem u kojem je znacajni evolucioni proces stvarno bio posmatran".

    Vecina uvodnih bioloskih udzbenika sada ilustruje ovaj klasican primer prirodnog odabiranja sa fotografijama dva varijeteta biberastih moljaca kako se odmaraju na svetlo i tamno obojenim stablima drveca (vidi sliku). Medjutim, ono sto udzbenici ne objasnjavaju jeste da su biolozi znali od 1980-tih da ovaj klasicni primer ima neke ozbiljne greske. Najozbiljnija je da biberasti moljci u divljini cak ni ne odmaraju na stablima drveca. Ispostavlja se da su udzbenicke fotografije izrezirane.

    U vecini Ketlevelovih eksperimenata, moljci su pustani i posmatrani za vreme dana. U samo jednom eksperimentu (18. jun, 1955.) Ketlevel je pustio moljce nocu, pred svitanje. Odmah je napustio taj pristup zbog prakticnih poteskoca koje su se nametale, kao na primer da je morao da prethodno zagreva hladne moljce na motoru svojih kola. Ali, biberasti moljci su nocni letaci i normalno nalaze mesta za odmor pre zore. Moljci koje je Ketlevel pustao za vreme dana ostajali su izlozeni i postajali lake mete za grabljive ptice. Uzimajuci u obzir svoje metode pustanja, Ketlevel je napisao: "Priznajem da bi po svom izboru, mnogi zauzeli pozicije u visim delovima drveca." Medjutim, pretpostavio je da moze da zanemari neprirodnost svoje tehnike.

    Kada su ptice hvatale Ketlevelove moljce, moljci nisu bili na svojim prirodnim mestima za sakrivanje. Ta cinjenica baca ozbiljnu sumnju na vrednost njegovih eksperimenata. Sredinom 1980-tih, italijanski biolozi \uzepe Sermonti (Giuseppe Sermonti) i Paola Katastini (Paola Catastini) kritikovali su Ketlevelova pustanja moljaca tokom dana i zakljucili da njegovi eksperimenti "ne dokazuju ni na jedan prihvatljiv nacin, po sadasnjim naucnim standardima, proces za koji on tvrdi da je eksperimentalno demonstriran". Sermonti i Katastini su zakljucili da su "dokazi koji su nedostajali Darvinu, takodje nedostajali i Ketlevelu".

    Godine 1998., evolucioni biolog sa Cikago Univerziteta, Dzeri Kojn (Jerry Coyne), pisao je pregled knjige Majkla Majerusa "Melanizam: Evolucija na Delu" (Melanism: Evolution in Action) u casopisu Nature. Kao sto smo videli, Majerus je branio klasicnu pricu, ali je takodje priznao probleme u vezi nje. A ti problemi su bili dovoljni da ubede Kojna da je prica u ozbiljnoj neprilici. "S vremena na vreme", pisao je Kojn, "evolucionisti preispituju klasicno eksperimentalno istrazivanje i otkrivaju, na svoj uzas, da ono ima greske ili je potpuno pogresno". Po Kojnu, cinjenica da se biberasti moljci ne odmaraju na stablima drveca "sama ponistava Ketlevelove eksperimente pustanja i ponovog hvatanja moljaca, jer su moljci pustani direktnim stavljanjem na stabla drveca".

    Medjutim, otvorite skoro svaki bioloski udzbenik koji se bavi evolucijom i naci cete biberaste moljce predstavljene kao klasican primer prirodnog odabiranja na delu - zajedno sa falsifikovanim fotografijama moljaca na stablima drveca. To nije nauka, vec stvaranje mita.

    Za vise informacija pogledati knjigu "Ikone evolucije" (Icons of Evolution), Dzonatan Vels (Jonathan Wells).

  4. #19

    Odgovor: Teorija evolucije ili kreacionizma

    Naravno, sad bih ja trebao da budem toliko dokon da bi za svaku neistinu koju si preneo, svaku istinu koju si istrgao iz kontexta demantujem i objashnjavam..

    I ovo do sada, natezanje da odbranim makar ovaj forum od bolesnih ideja je vechinom gubljenje vremena Narochito jer je dobrim delom na netu potrebniji psihijatar, da se izbori sa svim struchnjacima za vile i vilenjake, nego neko ko poznaje biologiju ili religiju.


    Biblija i kreacija nije nishta drugo do jedna NAUCHNA hipoteza. Vrhunac nauke i filozofije za ono doba u kome je stvorena. Poenta je u tome shto je ta hipoteza kasnije prevazidjena, a neki kao ti su od nje napravili neprevazidjeni fetish i dogmu, dok je nauka otishla svojim putem.




    (Kreacionisti, chak tvrde da su ljudi i dinosaurusi zziveli u isto doba. Znachi ne bilo kakvi veliki gmizavci, pojedinachne prezzivele vrste, vech komplet jurastic park koji nije prezziveo potop, dok je Noje eto, spasavshi kozzu od T-rexa i poplave poslate mu odozgo, nastavio ljudski rod...
    I sad ti isti meni prichaju kako je neko neshto docrtavao na crtezzima fetusa.)


    Niko ne spori dakle da se kroz istoriju nauke dolazilo do pogreshnih zakljuchaka i da se u neke od njih verovalo, sve dok se ne pokazze i dokazze suprotno, tj dok je ne zameni neka druga teorija. Ali ni jedna zabluda, nikakav pogreshan zakljuchak o Fluoru, ne onesposobljuje ljudske umove toliko dugo kao teorija o nastanku za 7 dana.

    Jedina razlika izmedju hrischanskih fanatika i talibana je u metodama
    Oduzmite talibanima pravo na ubijanje i rushenje, i ostatak retorike biche manje vishe isti. A, napredak drushtva kao i dobrobit istog podjednako brzo ostvaren.

    Ali dobro, nadajmo se da niko od kreacionistichkih zamlata i kojekakvih mistika, histerika i i dalje neche biti pitan za mishljenje kada se budu pravili bilo kakvi vazzni projekti kao shto je HCL, na primer

    Aj chao
    Poruku je izmenio HLEBmaster, 27.09.2008 u 09:59

  5. #20

    Odgovor: Teorija evolucije ili kreacionizma

    Citat HLEBmaster kaže: Pogledaj poruku
    (Kreacionisti, chak tvrde da su ljudi i dinosaurusi zziveli u isto doba. Znachi ne bilo kakvi veliki gmizavci, pojedinachne prezzivele vrste, vech komplet jurastic park koji nije prezziveo potop, dok je Noje eto, spasavshi kozzu od T-rexa i poplave poslate mu odozgo, nastavio ljudski rod...
    I sad ti isti meni prichaju kako je neko neshto docrtavao na crtezzima fetusa.)
    Vidiš da pojma nemaš Po kreacionistima svi dinosaurusi su izumrli do kraja--> posle potopa, zbog nemogučnosti da se prilagode novonastalim uslovima života na planeti....to je teorija! O izumiranju! Kao što i zastupnici konvencionalnog koncepta imaju mali milion teorija o izumiranju...ali odgovora još uvek nema!
    Ono što je činjenica, je da sve više i više pronalazaka/otkrića idu u prilog tome da su dinosaurusi živeli i u bliskoj prošlosti i sa ljudima!

    evo nekih:

    Tema o dinosaurusima u Bibliji je deo šire stalne debate u Hrišćanskim krugovima, o starosti zemlje, ispravnog tumačenja Postanja, i toga kako da tumačimo fižičke dokaze koje nalazimo svugde oko nas. Oni koji veruju u starije doba na zemlji, imaju tendenciju da se slažu da Biblija ne pominje dinosauruse, jer prema njihovoj paradigmi, dinosaurusi su izumrli milione godina pre nego što je prvi čovek kročio na zemlju. Ljudi koji su pisali Bibliju nisu mogli videti žive dinosauruse.

    Oni koji veruju u mlađe doba na zemlji, se slažu da Biblija pominje dinosauruse iako nigde ne koristi reč “dinosaurus.” Umesto toga, koristi se jevrejska reč tanniyn . Tanniyn je prevedena nekoliko puta na različit način u Engleskim Biblijama; ponekad, to je “morsko čudovište,” ponekad je to “zmija.” Najčešće je prevedena sa “zmaj.” Ovaj tanniyn izgleda da je neka vrsta gigantskog reptila. Ova stvorenja su pomenuta skoro trideset puta u Starom zavetu, i nalazila su se podjednako i u vodi i na zemlji.

    U prilog ovom pominjanju ovih gigantskih reptiala skoro tridest puta u Starom zavetu, Biblija opisuje nekoliko stvorenja na takav način, da neki naučnici veruju da pisci možda opisuju dinosauruse. Behemoth je bio najveće od svih Božijih stvorenja, gigant čiji je rep bio nalik kedrovom drvetu (Jov 40:15ff). Neki naučnici su pokušali da identifikuju Behemoth ili kao slona ili kao hipopotamusa. Drugi ukazuju na to da slon i hipopotamus imaju vrlo tanak rep, ništa slično sa kedrovim drvetom. Dinosaursi kao Brachiosaurus i Diplodocus su sa druge strane imali ogroman rep koji se lako može uporediti sa kedrovim drvetom.

    Skoro svaka prastara civilizacija je imala neku vrstu umetnosti koja je prikazivala gigantske reptile. Petroglifi, suveniri i čak male figurice od gline nađene u Severnoj Americi liče na moderan prikaz dinosaurusa. Duborez u kamenu u Južnoj Americi prikazuje ljude koji jašu stvorenja koja liče na Diplodocus i zadivljujuće su slični Triceratops-, Pterodactyl- i Tyrannosaurus Rex-stvorenjima. Rimski mozaik, keramika Maja, i zidovi Vavilonskog grada svedoče o ljudskoj međukulturološkoj, geografski neograničenoj fascinaciji ovim stvorenjima. Trezven izveštaj kao onaj od Marka Pola u Il Milione se meša sa fantastičnim pričama u kojima zveri čuvaju blago.

    Kao dodatak suštinskoj količini antropskih i istorijskih dokaza za istovremeno postojanje ljudi i dinosaurusa, postoje i drugi fižički dokazi, kao fosilni ostaci otisaka ljudskih stopala i stopala dinosaurusa nađenih zajedno u severnoj Americi i Zapadno-centralnoj Aziji.

    Sredinom 20. veka u dolini reke Paluksi, država Teksas, SAD, naučnici su otkrili okamenjene otiske stopala dinosaurusa. U izveštajima koji su usledili objavljeno je da su ovi otisci stopala nastali pre oko 100 miliona godina. Međutim, ono što je iznenadilo naučnike jeste da su neposredno pored otisaka stopala dinosaurusa pronađeni okamenjeni otisci stopala čoveka (slika).(1) Da li to znači da su dinoasurusi i ljudi živeli u isto vreme?

    Dodatno iznenađenje predstavljala je veličina ovih ljudskih otisaka. Prosečna dužina stopala savremenog čoveka iznosi između 20 i 25 centimetara, a dužina ovih stopala bila je 38 centimetara! Slični nalasci otisaka stopala otkriveni su i na mnogim drugim mestima, širom sveta.(2)
    Dakle, pred nama je naučni dokaz da su ljudi i dinosaurusi živeli u isto vreme, i da su ljudi bili mnogo krupniji (imali su skoro duplo veća stopala).
    Godine 1945, naučnici su kod mesta Akambaro u Meksiku otkrili veoma interesantno arheološko nalazište. Na tom mestu su svoje tragove ostavili ljudi koji su živeli u periodu od 800. godine pre nove ere do 200. godine nove ere. Među brojnim predmetima, arheolozi su pronašli više od 30.000 glinenih figurica, od kojih je nekoliko hiljada predstavljalo dinosauruse (slika).(4)

    Pitanje koje se nameće jeste: Kako su ovi ljudi znali da prave figurice dinosaurusa? Jedini mogući odgovor jeste da su oni imali priliku da ih vide.
    Druge figurice predstavljaju borbu ljudi i dinosaurusa (slika), dok neke pokazuju da su ljudi bili u stanju da ih pripitomljavaju (slika).


    Dakle, pred nama je još jedan naučni dokaz da su ljudi i dinosaurusi živeli u isto vreme. Ali, to nije sve.
    Na jednom drugom lokalitetu - ovoga puta u državi Peru - arhelozi su otkopali stare grobove naroda koji je tu živeo u periodu od 500. do 1500. godine naše ere.(5) U tim grobovima pronađeno je mnoštvo ćilima sa slikama dinosaurusa (slika), kao i ćupova i druge grnčarije, takođe sa slikama dinosaurusa (slika). Pronađen je i veliki broj kamenih ploča sa raznim crtežima, a na velikom broju ovih ploča nacrtani su zajedno ljudi i dinosaurusi (slika).

    Slični nalazi pronađeni su na mnogim drugim lokalitetima širom sveta.6 Očigledno da su u skoroj prošlosti ljudi živeli zajedno sa dinosaurusima, koje su čak i pripitomljavali.
    Da su dinosaurusi zaista živeli u skoroj prošlosti, a ne pre više desetina ili stotina miliona godina, svedoči pronalazak jaja dinosaurusa u kojima je sačuvan molekul DNK - molekul koji sadrži gene. U izveštaju se kaže da su ova jaja stara 70 miliona godina (slika 2.7). Ali, to ne može biti tačno jer se molekul DNK raspada relativno brzo posle uginuća organizma. Za manje od 6000 godina, kompletan molekul DNK bi se raspao.7 To znači da su ova jaja dinosaurusa mlađa od tog datuma.
    Otkriće ovih jaja dinosaurusa sa molekulom DNK dodatno je potvrdilo Mojsijev istorijski izveštaj u kome se kaže da su dinosaurusi živeli u skoroj prošlosti, i to zajedno sa ljudima. Pored toga, Mojsije beleži da su ljudi bili mnogo krupniji od savremenih ljudi i da su duže živeli.(slika)

    Veliki otisci stopala ljudi nisu jedini nalazi koji ukazuju na mnogo krupnije ljude koji su nekada živeli na našoj planeti. Na lokalitetima Perua i Meksika pronađene su fosilizovane ljudske lobanje, koje su po svojoj zapremini bile i do dva puta veće od lobanja savremenih ljudi (slika).(9) Ove lobanje imaju zapreminu od 2600 do 3200 kubnih centimetara, dok lobanje savremenih ljudi u proseku dostižu zapreminu od 1450 kubnih centimentara.

    Neobično izduženi oblici mnogih od ovih lobanja verovatno ukazuju na njihove običaje, jer je poznato da su neka domorodačka plemena u skorijoj prošlosti vezivala svojoj deci drvene predmete na čela. Tako su im deformisali lobanje, verujući da će to poboljšati njihov intelektualni razvoj.
    Krupni ljudi i krupne životinje, kao što su dinosaurusi, nisu ništa novo za naučnike. Do sada je otkriveno mnoštvo ostataka organizama koji ukazuju da su nekada i drugi organizmi bili krupniji.(10) Tako su svinje bile veličine današnjih goveda, a šumama su hodali jeleni čiji su rogovi bili široki preko 3 metra (slika).

    Paprati su bile veličine drveta, a drveće je bilo visoko i preko 30 metara. Nalazi ukazuju na razne skakavce i pauke koji su bili dugi i preko 60 centimetara, kao i na bube veličine bokserske rukavice.
    Mnogi će teško moći da zamisle dabra dugog dva i po metra, ali pronađena lobanja divovskog dabra, koja je danas izložena u naučnom centru Sent Luis ukazuje da je bio veličine crnog medveda (slika).
    Pronađeni su fosilni ostaci pingvina koji je bio velik skoro kao čovek (slika).
    Divovske ptice, čiji su ostaci pronađeni u centralnoj Australiji, bile su visoke najmanje 3 metra, a težile su preko 500 kilograma (slika).

    Ostaci bezrogog nosoroga, koji je verovatno bio najveći kopneni sisar, ukazuju da je bio visok skoro 5,5 metara i dug skoro 8 metara (slika).
    Fosili divovskih školjki, nađeni u državi Peru, pokazuju da su dostizale širinu od 3,5 metra i da su težile 320 kilograma (slika).
    Godine 1991, na obali Amazona pronađene su kosti krokodila čija je lobanja bila duga skoro 1,5 metar. Ovaj krokodil je bio visok 2,4 metra, dug 12 metara i težak oko 12 tona (slika).

    Pitanje koje se nameće jeste: zašto je živi svet nekada bio mnogo krupniji nego danas?
    Jedan drugi pronalazak mogao bi da nam da odgovor na ovo pitanje. U pitanju je otkriće drevnog čekića u steni (slika).(11)
    U istim slojevima stene pronađeni su i ostaci dinosaurusa. Sigurno da čekić nije pripadao dinosaurusu. Ali, ono što je za nas mnogo zanimljivije jeste hemijski sastav ovog čekića. Pod današnjim atmosferskim uslovima bilo bi veoma teško, skoro nemoguće, napraviti leguru od koje je načinjen ovaj čekić, što ukazuje da su uslovi za život na Zemlji nekada bili dosta drugačiji.
    Na veoma drugačije atmosferske prilike u prošlosti ukazuju i drugi fosilni nalasci. Tako su naučnici u ledu polarnih regiona pronašli fosile tropskih školjki (slika), što ukazuje da je tu nekada bilo tropsko more. Takođe, nedaleko od Severnog pola - tamo gde je danas večiti sneg i led - naučnici su pronašli fosilne ostatke zmija, krokodila i drugih organizama koji mogu da žive samo u uslovima tople klime.(12) U polarnim regionima pronađene su i velike naslage uglja, što ukazuje na nekadašnju bujnu vegetaciju tih prostora.
    Prema Mojsijevom istorijskom izveštaju, koji su oni prihvatali, klimatski uslovi na celoj planeti bili su nekada ujednačeni, kiša nije padala, i u takvim uslovima život je bujao na svim meridijanima.
    Činjenica je da fosilni ostaci biljaka i životinja ukazuju na to da danas živi samo 1% organizama od onih koji su nekada živeli na našoj planeti.(13)

  6. #21

    Odgovor: Teorija evolucije ili kreacionizma

    Ma zapanjujucha je samo religiozna posvechenost s kojom su ljudi spremni da potroshe vreme na proizvodnju ovakvih prevara.

    Ako su i tvoji otisci stopala ovakvi, bash mi je zzao zbog fizichkog poremechaja. Bog tu ne mozze pomochi, mada ortoped neshto i postigne.

    A figurice su anatomski verne samo ako si o dinosaurusima uchio iz kamenka i kremenka.

    By the way, poznato je da je njihov "pronalazach" plachao seljanima novog meksika da mu ih donose.
    32.000 figura u savrsheno ochuvanom stanju, i bez tragova zemlje ili prljavshtine i patine u reonu u kome nikada nije pronadjen ni fosil dinosaurusa? Zanimljivo.
    Koji metodi su korischeni za njihovo datiranje? Ja che ti kazzem - pogreshni!

    Gigantizam nekadashnjih zzivotinja nije sporan. Da su nekada vladali drugi uslovi na planeti nije sporno, inache ni evolucija ne bi ishla kako je ishla. Da su ljudi bili redom giganti sporno je, ali nishta revolucionarno ne znachi da jesu.

    Ajd ponovo neshto kopiraj iz riznice znanja

  7. #22

    Odgovor: Teorija evolucije ili kreacionizma

    Stvarno ne razumem toliku elementarnu neupucenost pobornika kreacionizma u nauku.
    Ne razumem izokretanje cinjenica, vrndanje poluistinama pa cak i falsifikovanjem.

    Sta zelite postici?
    Da kreacionizam moze biti veliki biznis u Americi, slazem se. Biznis je i crkva, biznis je i nauka.
    Sta je tu problem?

    Zasto me Bog pogadja hronicnom bolescu, kada ni mrava nisam zgazio?
    Zasto Bog pomaze mafijasima da se bogate na racun siromasnih klasa?


    Postovani kreacionisti, veze nemate sa principima nauke, naucnog istrazivanja, dokazivanjima i potpuno pogresno interpretujete naucne principe i rezultate.
    Slazem se da mi, pobornici nauke isto tako pogresno interpretujemo vas prilaz Bogu.
    Zato imate gornja dva pitanja da razradjujete, ja cu prihvatiti vas prilaz toj temi, iako mi je nebitno objasnjenje.

    Za postovane pobornike teorije evolucije cu postaviti pitanje, zasto se razna tkiva mrtvog organizma fozilizuju (kamenuju) raznim vrstama minerala, zasto je model drugog principa termodinamike univerzalan u svemiru i u cemu je njegova mana (da li i kada se ne moze ad acta), i da li verujete da se nevernicima u nauku mogu objasniti pojmovi kao sto su nasa cula, modeliranje, definisani pocetni uslovi, razne metode prilaska problemu,...?

    I da li mislite da je svemir sa svom svojom matematickom i fizickom skladnoscu i logikom mogao nastati bez ucesca nekog svemocnog (iz nicega ili necega) i da li bi narusavanje celog ovog sklada tvrdnjama koji se kose danasnjoj nauci stvaranja svemira pra 11 milijardi godina ustvar predstavljalo unosenje haosa i nenaucnog besmisla u nauku, sa vrlo mracnim posledicama po nas duhovni i materijalni svet (ne zaboravite, zivimo od onoga sto stvaramo-proizvodimo)? Ne bi li bas to bilo Bogohuljenje?
    Gospodine, vase dete se plazi na mene!

  8. #23

    Odgovor: Teorija evolucije ili kreacionizma

    Uvod u Evoluciju


    1. Od Darvina do danas


    U Darvinovo doba, nauka nije znala skoro ništa o tome kako deca nasleđuju osobine od roditelja (mada je bilo jasno da se to događa), kako se te osobine menjaju vremenom, i koji su osnovni mehanizmi po kojima se sve to događa. Darvin je svoje zaključke izveo na osnovu posmatranja kako se osobine organizama menjaju u skladu sa uslovima u prirodi, i na osnovu tada dostupnih i veoma nepotpunih fosilnih dokaza.

    Nedostajuća Veza?

    U ranoj naučnoj literaturi često se pominje ovaj koncept, koga i kreacionisti danas često pominju: a gde je nedostajuća veza, gde su prelazni fosili koji povezuju velike grupe života (recimo, beskičmenjake i kičmenjake)? Kreacionisti često tvrde da takvi fosili ne postoje, što nije bilo potpuno tačno čak ni u Darvinovo doba, ali sasvim sigurno nije tačno danas. Za opise mnogih prelaznih fosila, pogledajte tekstove na tu temu.
    Od tada do danas, evolucija je potvrđena masom dodatnih dokaza. Umesto hiljada klasifikovanih i proučenih fosila, danas imamo milione. Genetske analize i prodori na polju molekularne biologije omogućili su nam da napravimo planove genetskog razvitka i da ih uporedimo sa planovima fosilnog razvitka. Mnogi prelazni fosili koji povezuju stablo života u jednu celinu, nađeni su i izučeni. Delovi teorije koji su bili misterija i samom Darvinu danas su objašnjeni i analizirani.
    Ovaj tekst predstavlja uvod u današnju teoriju evolucije, koja je nastala na preseku svih pomenutih dokaza i koja se otud zove moderna sinteza. Pored analize razloga zbog kojih je teorija evolucije opšteprihvaćena kao objašnjenje za razvoj života na zemlji, dodatni cilj ovog teksta je da pokuša da ukloni neke od čestih zabluda u vezi sa evolucijom i načinom na koje evolucija funkcioniše. Čitaocima preporučujemo da prvo pročitaju ovaj tekst u celosti, pa da tek Važnost genetskih dokaza

    Jedno od osnovnih merila čvrstoće neke naučne teorije je pitanje koliko se ona uklapa u dokaze i činjenice koje se pojave nakon objavljivanja teorije. U Darvinovo doba, ništa nije bilo poznato o genetici, DNK, rekombinaciji... Da je nauka našla nešto što se ne uklapa u Darvinovu teoriju (recimo, da smo ustanovili da su mehanizmi nasleđa fiksirani, i da se geni ne menjaju nikada; ili da su geni čoveka značajno različiti od gena drugih životinja), cela teorija evolucije bi pala u vodu.

    Međutim, desilo se upravo suprotno. Sve što smo naučili do sada o genetici i molekularnoj biologiji ne samo što se uklapa u teoriju evolucije, već nema smisla osim u svetlu evolucije. Strukture nasleđa, genetske razlike između organizama, pa i sami detalji ćelijske biohemije daju neoborive dokaze za evoluciju. Darvinova teorija ne samo što nije oborena, već svake godine ima sve veći i veći uticaj u nauci.
    onda krenu da istražuju ostale tekstove na ovom sajtu. Važnost genetskih dokaza

    Jedno od osnovnih merila čvrstoće neke naučne teorije je pitanje koliko se ona uklapa u dokaze i činjenice koje se pojave nakon objavljivanja teorije. U Darvinovo doba, ništa nije bilo poznato o genetici, DNK, rekombinaciji... Da je nauka našla nešto što se ne uklapa u Darvinovu teoriju (recimo, da smo ustanovili da su mehanizmi nasleđa fiksirani, i da se geni ne menjaju nikada; ili da su geni čoveka značajno različiti od gena drugih životinja), cela teorija evolucije bi pala u vodu.

    Međutim, desilo se upravo suprotno. Sve što smo naučili do sada o genetici i molekularnoj biologiji ne samo što se uklapa u teoriju evolucije, već nema smisla osim u svetlu evolucije. Strukture nasleđa, genetske razlike između organizama, pa i sami detalji ćelijske biohemije daju neoborive dokaze za evoluciju. Darvinova teorija ne samo što nije oborena, već svake godine ima sve veći i veći uticaj u nauci.

    2. Mehanizmi Evolucije

    U većini modernih udžbenika biologije može da se nađe objašnjenje kako je evolucija zasnovana na mutaciji, prirodnoj selekciji, genetičkom driftu, i genetičkoj migraciji. Na tom mestu tekst obično postane previše tehnički, i dosadan mnogim ljudima, tako da malo ko u današnjem društvu zaista shvata kako evolucija funkcioniše. Stvari, međutim, zaista nisu toliko komplikovane.
    Osnovni činilac evolucije je mutacija, promena u genetskom kodu. Ove promene su neizbežan deo procesa reprodukcije, pošto proces kopiranja DNK nije savršen; pored gena nasleđenih od roditelja, svako ljudsko dete nosi između deset i trideset novih mutacija. Često se može čuti tvrdnja da su skoro sve mutacije “negativne”, i da izazivaju probleme i bolesti. Ovo nije tačno: velika većina mutacija su neutralne (ne menjaju funkciju produkta u dovoljnoj meri). Ako mutacija nije neutralna, ona može biti pozitivna ili negativna. Ključ evolucije je činjenica da negativnost ili pozitivnost mutacije zavisi od okoline u kojoj organizam živi.
    Ovo je drugi osnovni mehanizam evolucije, koga je predložio Darvin, i na kome je teorija evolucije originalno izgrađena: prirodna selekcija. Kako prirodna selekcija “bira” između različitih mutacija? Uzmimo jedan moderni primer evolucije u akciji; da bi stvari bile zanimljivije, uzmimo primer mutacije među ljudima samima.
    Jedna američka porodica nosi mutaciju u jednom od strukturalnih proteina kostiju, sa rezultatom da su njihove kosti značajno čvršće (i do četiri puta čvršće od normalnih ljudskih kostiju). Mutacija je nastala pre nešto više od sto godina u jednom od predaka porodice, i do danas se raširila na preko dvadeset njegovih potomaka. Da li je ova mutacija pozitivna ili negativna? U današnjem dobu automobilskih nesreća, padova, i sličnih događaja u kojima ljudsko telo biva izloženo raznim velikim šokovima, ova mutacija se pokazala kao veoma pozitivna, što je i razlog njenog (do sada) uspešnog širenja.
    Međutim, tu su uvek i drugi aspekti. Tvrđe kosti su takođe i gušće, što znači da ljudi koji nose ovu mutaciju teže plivaju. Takođe, za normalan razvoj im je potrebno više kalcijuma. Dakle, mutacija nije prosto pozitivna bez kvalifikacija: ona je pozitivna u današnjoj Americi, gde je lako pribaviti hranu bogatu kalcijumom, i gde ljudi uglavnom ne moraju da plivaju (osim možda radi zabave i rekreacije).
    Zamislimo da se ista ova mutacija desi čoveku sa Šri Lanke, rođenom u porodici lovaca na školjke. Tvrđe kosti bi samo doprinele da on bude lošiji plivač, i mutacija bi za njega bila negativna. Isto važi i za nekoga ko živi u centralnoj Africi, gde je teško doći do velikih količina hrane bogate kalcijumom: ova mutacija bi ga učinila slabim i bolešljivim, i bila bi negativna. U Šri Lanci i Africi, nikada ne bi nastala porodica ljudi koji nose ovu mutaciju, pošto ljudi kod kojih se ona pojavi ne bi mogli da uspešno prežive.
    Ako razumemo ova dva osnovna koncepta, možemo da razumemo i prvi sistem specijacije (nastanka novih vrsta): nova vrsta će nastati kada se selektivni pritisci okoline na već postojeću vrstu promene, ili kada već postojećoj vrsti postane dostupna nova okolina.

    Šta su to uopšte mutacije, i kako one funkcionišu? Zašto je većina mutacija neutralna? Pogledajte ovde.

    Uzmimo za ilustraciju početak evolucije udova (nogu) iz peraja, ovaj put koristeći fosilne ostatke da rekonstruišemo redosled događaja. Priča počinje sa primitivnijim ribama poznatim kao Palaeoniscoide. Neke od dotičnih su naselile tzv. sezonske reke, vodene tokove koji jedan deo godine budu puni vode (obično u proleće, kada topljenje snega na planinama nosi svežu vodu u doline), dok se u drugim delovima godine pretvaraju prvo u bare, a ponekad se i potpuno osuše.
    U ovim tokovima, Palaeoniscoide su imale obilan izvor hrane, ali i veliki problem u obliku sezonskih sušenja. Naime, kada reka presuši, riba mora da se nada da će završiti u dovoljno velikoj bari, i da ta bara neće i sama presušiti pre nego što naiđe sledeća bujica. Kada se nađe u maloj bari i kada počne da joj nestaje vode, riba može da pokuša da propuzi kroz mulj do sledeće bare, nadajući se da će ta biti veća.
    Palaeoniscoide su naselile ove tokove iz dublje vode, i njihova peraja su bila prilagođena za plivanje kroz vodu. Takva peraja, međutim, nisu uopšte bila upotrebljiva za puzanje kroz mulj. Ali, geni kontrolišu oblik, veličinu, i položaj peraja; mutacije mogu da promene sve te faktore, i među desetinama hiljada riba koje su živele u ovim tokovima postojao je čitav spektar mutacija. Neke su imale oštrija peraja, neke oblija, neke više isturene prema dole, neke više isturene na stranu... One ribe koje su imale obla peraja isturena na stranu najbolje su prolazile u sezonskim rekama, pošto su mogle da koriste ta peraja da se njima odupiru o mulj. Ribe koje su imale oštra peraja okrenuta nadole najgore su prolazile, pošto su im takva peraja samo smetala u puzanju. Prve su preživljavale i ostavljale potomke; ove druge su polako ali sigurno izumrle u novoj okolini.
    Posle više desetina hiljada generacija selekcije, u sezonskim tokovima se razvila čitava nova grupa ribljih vrsta (Osteolepis je dobar primer) čija su peraja postala veoma dobro razvijena za funkciju guranja kroz mulj. Raspored i broj kostiju u ovim perajima je postao shema na kojoj su izgrađeni udovi svih kasnijih vodozemaca, guštera i sisara.

    Peraja nisu bila jedina promena koju je nova okolina izazvala. Palaeoniscoide koje su živele u sezonskim rekama su takođe prve razvile jedan od ključnih organa za život na kopnu: pluća, koja su originalno korišćena da pomognu ribi da pliva kroz veoma blatnjavu vodu sa malom količinom kiseonika. Takođe, novi uslovi su značajno uticali na oblik tela, položaj škrga, i mnoge druge aspekte telesne organizacije. Dodatni opis daljeg razvoja Palaeoniscoida do vodozemaca dat je niže u ovom tekstu, a za detaljniju obradu nastanka drugih struktura i mnoge dodatne primere možete pogledati detaljan tekst o prelaznim fosilima.

    Važno je ovde primetiti jednu stvar koja često zbunjuje ljude: prirodna selekcija nije “inteligentna sila” koja bira neke organizme zato što njihov razvoj vodi ka nekom određenom cilju; Palaeoniscoide nisu počele da evoluiraju “da bi jednog dana od njih nastale žabe”. Ono što se desilo je mnogo jednostavnije: u okviru iste vrste riba, neke su imale malu prednost u odnosu na druge, i te su češće preživljavale suše, duže su živele, i ostavljale su više potomaka. Potomci tih uspešnih riba su nastavili da nose njihove uspešne gene. Neuspešne ribe nisu preživljavale, nisu ostavile potomke, i njihove osobine su polako nestale iz te određene populacije riba.
    Takođe je važno primetiti da se ovo desilo samo sa jednim delom Palaeoniscoida, onim koji je naselio sezonske reke. Palaeoniscoide koje su ostale da žive u dubljim vodama nisu bile pod istim pritiscima, i njihova evolucija je išla potpuno drugačijim tokovima, sa potpuno drugačijim rezultatima.
    Stvar koju treba primetiti jeste da evolucija nije nešto što ide “od manje kompleksnog ka kompleksnijem”, ili od goreg ka boljem. Iste promene na perajima koje su im omogućile da lepo žive u sezonskim rekama i plitkim barama ovim bi ribama bile velika smetnja u dubokoj vodi. One nisu postale “bolje” ili “razvijenije”, već prosto prilagođene svojoj životnoj sredini.

    Ostala su nam još dva važna mehanizma u evoluciji - genetički drift i genetičke migracije. Genetički drift je važniji za ovu diskusiju, pošto predstavlja drugi važan način na koji nove vrste nastaju od starih.

    Genetički drift se događa kada jedna vrsta bude na neki način podeljena na dva ili više delova. U jednom delu vrste se događa jedna serija slučajnih mutacija, u drugom delu se događa druga. Promene ne moraju da budu velike, čak mogu biti nevidljive spolja, ali posle dovoljnog broja generacija nakon odvajanja, odvojene populacije postaju toliko genetski različite da više ne mogu da proizvedu zajedničko potomstvo: postaju dve nove vrste. Klasičan primer ovoga je losos: jedna pra-vrsta riba, koju je podizanje Paname podelilo na dva grupe u dva okeana. Iako su njihovi uslovi života ostali isti, spora akumulacija razlika je dovela do toga da danas postoje dve grupe vrsta, pacifička i atlantska.

    Genetički drift je takođe predmet jednog od najdužih eksperimenata u evoluciji, koje više od dve decenije sprovodi Ričard Lenski. Lenski i njegova grupa su pre više od dvadeset godina jednu bocu sa kulturom E. coli bakterija podelili na tri dela. Ove tri kulture su onda gajene godinama odvojeno, i genetički drift je kroz 25,000 generacija polako uradio svoje. Danas, Lenski ima tri različite podvrste E. coli u svojoj laboratoriji. Jedna podvrsta formira kupaste strukture na dnu boce u kojoj raste, i veoma se čvrsto pripija uz staklo. Druga podvrsta lebdi slobodno u tečnosti, i organizuje uspravne kolumne u kojima se ćelije stalno kreću iz dubine ka površini i nazad, tako da sve ćelije imaju priliku da upiju dovoljno kiseonika. Treća podvrsta se organizuje u tanak biofilm na površini tečnosti.

    Sve tri su nastale od iste grupe originalnih ćelija, sve tri su rasle u istim uslovima (tako da nije reč o prirodnoj selekciji). Razlike u načinu i brzini rasta, kao i razlike u ponašanju, su potpuno rezultat genetičkog drifta, slučajnih mutacija koje su se različito akumulirale u odvojenim populacijama.

    Genetička migracija je obrnuta situacija: tok gena između dve grupe unutar iste vrste koje bi se inače brzo razdvojile. Na primer, mnoge vrste severnoameričkih ptica mogu biti podeljene na tri podvrste: istočnu, zapadnu, i hibridnu. Pripadnici istočne vrste ne mogu da se pare sa pripadnicima zapadne vrste, imaju drugačiju boju perja i drugačije pesme. Hibridna populacija koja živi u centralnom delu Severne Amerike, međutim, može da se pari sa obe vrste, i kroz nju geni, veoma polako, bivaju prenošeni sa jedne obale kontinenta na drugu.


    Zašto su genetičke migracije važne? One su “sila” koja vezuje vrstu u jednu celinu, i u njemu je razlog što vrste mogu da ostanu iste milionima godina. Nakon određenog (velikog) broja generacija, vrsta se potpuno prilagodi svojoj okolini: sve značajne pozitivne mutacije koje se lako mogu desiti -dese se i prirodna selekcija odabere one koje najbolje odgovaraju okolini. Mutacije se i dalje događaju, naravno; ali one su velikom većinom ili neutralne ili negativne, tako da ili nemaju uticaja, ili njihovi rezultati bivaju brzo izbačeni iz igre. Blago pozitivne mutacije ne mogu da se akumuliraju, pošto u velikoj populaciji vrlo brzo budu potopljene u moru drugih blago pozitivnih i blago negativnih. Iz ovog razloga, recimo, su ajkule ostale veoma slične svojim precima (mada ne identične).

    Ako se gentička migracija, međutim, prekine, onda genetički drift i prirodna selekcija stupaju u igru, i počinje rađanje novih vrsta. Dobar primer ovoga je Kineski zid, koji je podelio populacije biljaka u Kini, i prekinuo genetičku migraciju između njih. Kao rezultat, nastale su mnoge nove vrste divljeg cveća i trava, sa različitih strana zida.

    Da sumiramo:

    Mutacija neizostavno vodi prvo u tzv. mikroevoluciju, stvaranje malih razlika unutar iste vrste. Genetičke migracije održavaju vrstu homogenom, utapajući nove mutacije u opštu populaciju, i čineći da svi pripadnici imaju veoma sličan genetski sklop – različiti su u malim detaljima, ali slični u opštoj strukturi.

    Prekidanje genetičkih migracija pokreće specijaciju. Ako se populacija prosto podeli na dva ili više delova, genetički drift će veoma, veoma polako izazvati podelu vrste na više novih vrsta. Ako se deo populacije nađe u novim, značajno drugačijim uslovima života, prirodna selekcija će delovati na prethodno male razlike, čineći ih sve većim, dok od te izdvojene grupe ne nastane nova vrsta.

    Koliko brzo se mutacije šire kroz populaciju?

    Veoma negativne se ne šire praktično uopšte, blago negativne se šire sporo, pozitivne se šire veoma brzo. Brzina širenja je, međutim, relativna stvar, zavisna od vrste, dužine života jedinke, dužine reproduktivnog ciklusa, i mnogih drugih faktora.

    Zanimljivo merilo koliko se jedna mutacija može raširiti u populaciji počevši sa jednom jedinkom možemo dobiti iz širenja porfirije u Južnoj Africi. Porfirija je blago negativna mutacija, poremećaj metabolizma kod čoveka, koji nije dovoljno negativan da bude značajan utican na njegovu sposobnost da ostavi potomstvo. 1680 godine, bračni par Ariaantje i Gerrit Jansz emigrirao je iz Holandije u Južnu Afriku; jedno od njih dvoje je nosilo u sebi gen koji proizvodi porfiriju. Danas u Južnoj Africi živi više od 30,000 njihovih potomaka koji pate od bolesti, i još najmanje dva puta veći broj potomaka koji nose gen ali nemaju simptome. Čak i kod sporo-reprodukujuće vrste kao što su ljudi, hiljadu godina je dovoljno da jedna mutacija bude prenesena na stotine miliona jedinki. Kod vrsta koje se brže razmnožavaju, ovo širenje je još brže.

  9. #24

    Odgovor: Teorija evolucije ili kreacionizma

    3. Neke ilustracije evolucije




    a) Prstenaste vrste

    Jedna dobra ilustracija evolucije u akciji je koncept “prstenastih vrsta”, konglomerata genetski povezanih populacija koje je genetski drift doveo na ivicu podele u nove vrste. Tri najpoznatija primera su kalifornijski salamander (Ensantina eschscholtzi), polarni galeb, i zeleni slavuj (Phylloscopus trochiloides). Za ilustraciju koncepta, u okviru ovog teksta ćemo upotrebiti slavuja.
    Zeleni slavuj je ptica koja živi u planinskim šumama, i potiče iz oblasti Himalaja (mesto označeno sa A na mapi ispod). Šireći se iz svoje početne oblasti, prelazeći sa planine na planinu, populacija zelenog slavuja se raširila u prstenu oko Tibetanske stepe (u kojoj nema dovoljno drveća da bi slavuj uspeo da preživi).



    Šireći se oko Tibeta, međutim, populacije slavuja u odvojenim područjima su postajale sve udaljenije jedna od druge. Genetički drift je ovde stupio na snagu, i populacije su postajale sve različitije i različitije. Boja i oblik perja su postali značajno različiti između odvojenih populacija.

    Seksualna selekcija je takođe stupila na snagu: slavujeva pesma se polako menjala zajedno sa selidbom, što je dovelo do dodatne izolacije među populacijama: ženka jedne grupe više “ne razume” pesmu mužjaka druge grupe, i time je međusobno ukrštanje otežano.

    Kakav je ukupan efekat ovih događaja? Susedne grupe su još uvek dovoljno genetski i vizuelno slične da bi mogle da se pare. Slavuji iz grupe A se redovno pare sa slavujima iz grupa F i B, na primer; ređe sa slavujima iz grupa C i G. Međutim, kada se udaljenost poveća, više nema parenja: parovi se nikada ne uspostavljaju između grupa E i A, ili F i D. A na samim ivicama prstena, dolazi do situacije u kojoj su genetske promene dovoljno velike da sprečavaju ukrštanje: slavuji iz grupa G i H ne mogu da se pare jedni sa drugima, pošto je genetska udaljenost postala suviše velika.

    Posmatrajući zelenog slavuja, možemo videti mehanizam gradacije vrsta u akciji: susedne grupe još uvek pripadaju istoj vrsti, ali kada udaljenost postane suviše velika, moramo početi da govorimo o dve vrste slavuja.
    b) Rekonstrukcija na osnovu fosila. Primer: nastanak vodozemaca

    Ali slavuji su i dalje slavuji, neko će reći. To je svakako tačno; ali ista vrsta promena koja vodi podeli jedne vrste slavuja na dve vrste, neizostavno vodi i u dalje promene koje postaju sve veće i veće kako vreme prolazi. Mi to, međutim, ne možemo lako da pratimo, pošto proces traje previše dugo.

    Prateći takozvani “genetski časovnik”, naučnici koji izučavaju zelene slavuje utvrdili su da je širenje vrste počelo pre otprilike deset hiljada godina. Drugim rečima, da bi se stiglo od jedne vrste slavuja do današnje “skoro dve”, trebalo je da prođe deset milenijuma! Za veće promene, treba još više vremena. Ako slavuji ne izumru, mutacije će ih polako ali neminovno, pre ili kasnije, pretvoriti u nešto potpuno drugačije od onoga što su danas...ali mi to ne možemo videti, pošto ne možemo da sedimo i posmatramo slavuje sledećih par miliona godina.

    Za praćenje većih promena kroz duge vremenske periode, moramo se osloniti na fosile. Takozvani prelazni fosili nam pokazuju kako su vrste polako nastajale jedna iz druge, i kako su se osnovne karakteristike živih bića menjale kroz istoriju. Za primer možemo uzeti Palaeoniscoide o kojima smo već govorili. U prethodnom tekstu, objašnjeno je kako je Osteolepsis nastao od originalnih Palaeoniscoida...ali šta se desilo sa njim nakon toga?

    Da se podsetimo: Osteolepsis i dalje ima peraja, ali sa skupom debelih kostiju u peraju koje će kasnije postati prsti, i primitivnim "laktom" u pregibu peraja. Osteolepsis je takođe imao primitivna pluća, razvijena najverovatnije iz veoma dobro prokrvljene kesice u okviru sistema za varenje. Iz grupe vrsta veoma sličnih Osteolepsisu je pocela linija koja je dovela do vrste Eusthenopteron.

    Eusthenopteron i dalje ima samo peraja, ali je raspored kostiju u perajima i raspored mišića prilagođen odgurivanju niz mulj više nego plivanju. Zadnja peraja imaju primitivna kolena, lakat u prednjim perajima je potpuno razvijen. Takođe, Eusthenopteron poseduje nozdrve, koje pokazuju da je organizam često udisao vazduh van vode.

    Panderichtys je sledeći korak, ključni u prelazu ka vodozemcima. Najveći deo tela ove “ribe” je potpuno analogan ranim vodozemcima – građa lobanje je identična, kost za kost. Kosti prednjih i zadnjih peraja postaju analogne kostima koje poseduju svi kopneni kičmenjaci: humerus, ulna i radius u prednjim udovima, i femur, tibija i fibula u zadnjim udovima. Osim ova dva para peraja koja odgovaraju udovima četvoronožaca, preostala peraja (leđna i analna) zakržljavaju. Kod ove vrste se prvi put pojavljuje čoana, prolaz koji povezuje nos sa ustima i omogućava disanje kroz nozdrve.

    Primer daljeg razvoja je Acanthostega, i dalje ribljeg tela, ali sa izduženim (mada nesavitljivim) nogama. Acanthostega je imala i pluća i škrge istovremeno, kosti lobanje istovetne vodozemačkim (ali još uvek ribljeg oblika), ribljom vezom između lobanje i kičme, vodozemačkim zubima, ribljom lateralnom linijom...nemoguće je reći da li se radi o ribi ili o vodozemcu.

    Ovde dolazimo do Ichthyostege. Ichthyostega pokazuje jednu veoma značajnu vezu: oblik lobanje i njena unutrašnja podela su identični Eusthenopteronu, i imaju seriju karakteristika koje su jedinstvene među svim kičmenjacima.

    Ichthyostega već sasvim jasno imaja stopala, mada se ona i dalje završavaju izraslinama koje su slične perajima, i nemaju članak na nozi. Rep je dugačak i mišićav, tipičan za amfibijske životinje, ali i dalje ima repno peraje iznad i ispod celom duzinom. Laktovi i ramena su prilagođeni ne samo odgurivanju, vec i izdignutom hodanju iznad čvrste povrsine. Veoma važna činjenica je da je Ichthyostega i dalje vodena životinja, sa jasno definisanim škrgama, i da je mogla da preživi van vode samo ograničeno vreme (inače bi se škrge osušile).

    U ovom periodu nailazimo na nešto što je dugo predstavljalo problem za rekonstrukciju evolucije vodozemaca. To je takozvani “Romerov prekid” – period iz koga nismo imali nikakve fosile. Ovo se promenilo nedavno, kada je u Julu 2004 objavljen nalaz fosila iz ovog perioda. Nazvan Pederpes finnae, fosil pokazuje sledeći korak u prelazu.

    Acanthostega i Ichthyostega su imali prste kojima su mogli da se odupru o čvrsto zemljište, ali Pederpes je prva vrsta za koju znamo da je posedovala razvijen članak, sa stopalom usmerenim unapred umesto prosto raširenim paralelno sa telom. Po obliku tela je bio veoma sličan Acanthostegi, ali imao je dovoljno snažne udove za hodanje po čvrstom tlu, i veoma primitivno čulo sluha.
    Poslednja karika u ovom delu lanca su kasniji Labyrinthodonti (više stotina vrsta; Pholidogaster i Pteroplaks su dobri primeri). Oni i dalje pokazuju osobine slične Ichtyostegi i Acanthostegi: tipični raspored kostiju lobanje, lobanja je povezana sa kičmom kao kod riba, zubi su i dalje riblji. Udovi su, međutim, potpuno razvijeni, sada bez tragova peraja, više nema peraja ni na repu, a nosne šupljine su takođe potpuno razvijene. Čulo sluha je još uvek primitivno ali daleko razvijenije nego kod Pederpesa. Plućno disanje je potpuno prevagnulo, i škrge su skoro sasvim nestale: Labyrinthodonti više nisu mogli da žive pod vodom, bez disanja spoljnog vazduha.

    Za dodatne primere rekonstrukcije evolucije na osnovu fosila pogledajte duži tekst o prelaznim fosilima. Za detaljniju analizu ovde pomenutih prelaznih fosila između riba i vodozemaca, sa slikama, pogledajte ovde.

    Iz Labyrinthodonta je krenulo grananje koje je sa jedne strane (preko amniota) odvelo do gmizavaca, a sa druge strane kroz niz grananja moderne grupe amfibijskih organizama.
    d) Ugnježdena hijerarhija

    Ugnježdena hijerarhija je jedna od ključnih opservacija koje su dovele do razvitka teorije evolucije. Radi se o opservaciji da se sav život na zemlji može podeliti na kategorije koje se uklapaju jedna u drugu, kao grane drveta – ili, tačnije, kao grane iste porodice, u kojoj potomci nasleđuju osobine predaka.

    Da ilustrujemo ovaj koncept na primeru čoveka. Ovaj deo nekima može biti dosadan, ali predlažem čitaocu da stisne zube i pročita do kraja – jer je zaključak koji sledi iz cele ove priče neosporiv.

    U samoj osnovi podele živih bića na svetu jeste podela na tri osnovna domena: arhaebakterije, eubakterije, i eukariote; uobičajeno je da se arhaebakterije i eubakterije zajedno nazivaju prokariote. Između ovih grupa postoji mnogo razlika, ali najuočljivija je ta da eukariote imaju ćelijsko jezgro; prokariote ga nemaju. Takođe, eukariote imaju ćelijske organele (mitohondrije, hloroplaste, itd.), drugačiji sistem proizvodnje proteina, DNK spakovanu u hromozome, i mnoge druge ćelijske strukture koje su na daleko razvijenijem nivou nego kod prokariota.

    Ljudi su eukariote: ćelije čoveka imaju jezgro, organele, hromozome...isto kao i sve druge eukariote, od algi do riba.

    Reći da je nešto eukariota ne sužava izbor previše. Među eukariotama se nalaze nekoliko podgrupa poznatih kao carstva – biljke, gljive, crvene alge, metazoe... metazoe, ili popularnije, životinje, jesu carstvo kome pripada čovek. Za razliku od većine drugih eukariota, metazoe ne proizvode sami sebi hranu, već moraju da jedu druga živa bića. Metazoe takođe imaju specifične ćelijske osobine – nemaju ćelijske zidove, već samo membranu, a ćelije mogu biti međusobno povezane kanalima i specifičnim vancelularnim proteinima kao sto je kolagen. Ovo su osobine svojstvene metazoama – druge eukariote ih nemaju.

    Metazoe su i dalje veoma široka grupa organizama: od pljosnatih crva do lavova, sve životinje imaju osnovnu grupu osobina koje ih čine metazoama. Kada se pogledaju razlike među metazoama, može se primetiti da postoji nekoliko grupa, zvanih filumi. Jedna od ovih grupa su Chordate, životinje koje imaju skup nerva u leđima poznat kao notokord, ljudima poznatiji kao kičmena moždina. Ovoj grupi pripada i čovek. Čovek takođe ima lobanju, što ga stavlja u podgrupu Chordate poznatu kao kranijati.

    Chordate se dele na nekoliko podfiluma, od kojih čovek pripada kičmenjacima: grupi životinja koje imaju tvrdu kost oko svog notokorda.
    Čovek je takođe tetrapod: ima četiri uda sa određenim brojem i rasporedom kostiju, i sistemom veze tih udova sa kičmom.

    Tetrapodi se mogu podeliti na više grupa. Jedno od merila je struktura lobanje, po kojoj se razlikuju anapsidi (kao što su kornjače), diapsidi (reptili, ptice), i sinapsidi (među kojima je i čovek). Od svih sinapsida koji su živeli na svetu, preživela je samo jedna klasa: sisari (Mammalia). Sisari su toplokrvni, imaju sposobnost da proizvode mleko kojim hrane mladunčad, i imaju dlake umesto krljušti. Čovek je sisar.

    Sisari se dele na podklase Monotrema (sisari koji ležu jaja, od kojih je platypus jedini preživeli član), Marsupialia (sisare koji rađaju mlade veoma rano, pa ih onda odgajaju u vrećama na prednjem delu tela, na primer kenguri) i Eutheria (sisari koji imaju placentu koja održava mladunčad živim unutar materice). Ljudi su eutheria, placentalni sisari.

    Eutheria se dalje deli na nekoliko redova, među kojima je i Primates. Svi primati imaju pet razvijenih prstiju na rukama i nogama. Svi primati imaju dve dojke, i one se nalaze na grudima, umesto na stomaku (kao kod većine drugih eutheria). Umesto kandži ili kopita, imaju nokte. Jedini od svih životinja na svetu (osim zamoraca, koji su tu sposobnost izgubili na potpuno različit način), primati ne mogu da proizvode vitamin C, već moraju da ga uzimaju kroz ishranu.
    Red Primates se deli na nekoliko porodica, od kojih je jedna Hominidae (hominidi). Hominidi nemaju rep, već samo zakržljali ostatak koji čak i ne viri kroz kožu. Svi hominidi imaju isti oblik kutnjaka, mnogo pokretljivija ramena nego drugi primati, znatno veći kapacitet lobanje (i time znatno veći mozak), i sposobnost za stajanjem i hodanjem na dve noge. Ovaj skup osobina je nešto što poseduje veoma mala grupa životinja: čovek, orangutan, šimpanza, gorila i bonobo.
    Konačno, dolazimo do genusa Homo, čovek, od koga je jedina živa vrsta danas Homo sapiens, razumni čovek – po pretpostavci, i pisac ovih redova, i onaj koji ove redove čita.
    Mada je biolozima i biohemičarima još od samog početka jasno zašto ova hijerarhija podrazumeva zajedničko nasleđe, većini ljudi je ovo suvoparno nabrajanje činjenica i mnogima je nejasno zašto je ovo tako dobar dokaz evolucije. Do objašnjenja možemo doći ako idemo unazad:
    Radi se o prostoj činjenici da sve navedeno nema smisla u stvorenom svetu, već samo u okviru evolucije. Da je svet stvoren, bilo bi očekivano da svaka životinja ima ono što joj je potrebno za što bolje preživljavanje. To bi podrazumevalo da bi sve osobine bile podeljene i izmešane među svim životinjama. Međutim, to nije ono što vidimo.
    Svi članovi porodice Hominidae imaju određenu grupu osobina koje nema nijedna druga životinja na planeti. Razlog je što svi hominidi potiču od jednog istog, zajedničkog pretka. Na osnovu osobina koje hominidi dele sa primatima, znamo da je zajednički predak hominida bio primat.
    Svi primati imaju određen skup osobina koji, opet, nema nijedna druga životinja na planeti. Svi primati su osetljivi na virus side. Nijedan primat ne može da proizvodi vitamin C. Svi primati dele istu arhitekturu tela. Ovo je tako zato što svi primati potiču od istog pretka, koji je bio placentalni sisar.
    Svi placentalni sisari imaju zajedničke osobine. Sve životinje koje imaju placentu su sisari – ne postoje životinje koje imaju placentu, a nisu sisari. Razlog za ovo je što su svi placentalni sisari nastali od istog pretka koji je bio sisar.
    Svi sisari imaju zajedničke osobine. Sve životinje koje imaju mlečne žlezde imaju i druge osobine sisara: ne postoje gušteri ili ptice sa mlečnim žlezdama. Svi sisari su toplokrvni. Svi sisari imaju dlake. Zašto nema sisara sa krljuštima? Zašto nema guštera koji doje mladunčad? Zato što su ove osobine bile osobine zajedničkog pretka, od koga su nastali svi sisari. Svi sisari su sinapsidi, zato što je i njihov predak bio sinapsid.
    Taj predak je takođe bio tetrapod. Svi diapsidi, sinapsidi, i anapsidi su tetrapodi, zato što je zajednički predak iz koga su sve ove grupe nastale bio tetrapod. Svi tetrapodi su kranijati – svi imaju lobanju. Svi su takođe i kičmenjaci.
    Postoje životinje koje imaju kičmu, ali nemaju lobanju. Međutim, svaka životinja na svetu koja ima lobanju ima i kičmu. Zašto? Zato što je prvi kranijat bio kičmenjak. Isto važi i za vilicu i zube: ne postoji životinja na svetu koja ima vilicu i zube, a nema kičmu. Za ovo ne postoje anatomski razlozi – da je život stvoren, vilicu i zube bi mogle imati razne druge životinje. Međutim, pošto je život evoluirao, imaju ih samo potomci onog kičmenjaka kod koga su se vilica i zubi prvi razvili. Taj kičmenjak je takodje pripadao filumu Chordate.
    Nemaju sve životinje sa notokordom kičmu, ali one koje imaju uvek imaju i notokord. Nemaju sve životinje notokord, ali sva živa bića koja imaju notokord su životinje (ne postoje biljke ili gljive sa notokordom). Sve eukariote nemaju kolagen, ali zato su sva živa bića koja koriste kolagen eukariote.
    Ova struktura, koju smo obradili samo za jednu vrstu, čoveka, važi za sve vrste na svetu! Umesto tragova dizajna, pravljenja vrsta tako da odgovaraju određenoj sredini ili ponašanju, ono što vidimo u prirodi su tragovi zajedničkog nasleđa: podela osobina na osnovu zajedničkih predaka – tekovina vrsta koje su se delile na podvrste kako je vreme prolazilo.
    Na genetskom nivou, ovo je još jasnije vidljivo. Poređenje gena sa istom funkcijom pokazuje da su sličnosti sve veće kako se srodnost sve bliža – potpuno jednako kako se to događa kada se porede geni unutar porodice! Ako poredimo rođenu braću, oni će biti genetski mnogo sličniji nego kada poredimo braću od strica. Isto je i kada poredimo različite vrste: grana života iz koje su nastale biljke davno se odvojila od stabla iz kog smo nastali mi. Ako uporedimo gene biljaka sa našima, naći ćemo mnoge sličnosti (jer i biljke i mi smo eukariote), ali i mnoge razlike. Ako uporedimo gene gmizavaca, od kojih smo se odvojili znatno kasnije, biće mnogo više sličnosti i mnogo manje razlika. Konačno, ako uporedimo gene sa našim najbližim rođacima, šimpanzama, naći ćemo zapanjujuću sličnost od 98%!


    Pomenuti vitamin C je odličan primer genetskog nasleđa. Naime, predak svih primata je imao mutaciju na jednom od gena neophodnih za proizvodnju vitamina C. Taj predak je živeo u džungli, kao i većina primata posle njega, gde su mu bili dostupni sveži plodovi. Pošto je iz plodova dobijao dovoljno vitamina C, pomenuta mutacija je za njega bila neutralna; on je preživeo, i svi njegovi naslednici su nasledili tu mutaciju. Svi primati u svojoj DNK nose ovaj oštećeni gen: i moderni čovek u svakoj svojoj ćeliji nosi kopiju ovog gena, sa greškom koja ga onesposobljava. Kao i svi moderni primati, moderan čovek mora da nastavi tradiciju svog prapretka: mora uzimati dovoljno vitamina C, inače će da oboli od skorbuta.
    Poruku je izmenio HLEBmaster, 28.09.2008 u 14:08

  10. #25

    Odgovor: Teorija evolucije ili kreacionizma

    Evolucija Čoveka

    I Uvod

    Teorija evolucije povezuje sav živi svet u jednu veliku celinu. Najpre pomoću fosila, a danas posredstvom genetskih analiza, naučnici proučavaju nastanak naše vrste počev od jednoćelijskih organizama, istražujući grananje drveta života i tražeći mesta gde su se prapreci raznih vrsta rastali...

    Za mnoge ljude evolucija je fantastična ideja, pomoću koje se može sagledati povezanost svega što postoji, i na osnovu koje se može uočiti čovekovo mesto u opštoj shemi postojanja. Za druge, nažalost, ovo je uvreda - kako iko može da tvrdi da je čovek nastao od majmuna? Ovo pitanje se često koristi kao ključni argument u preziru prema nauci i često se može čuti kako kreacionisti nazivaju teoriju evolucije “majmunskom teorijom” ili kako same naučnike nazivaju majmunima.

    Ova reakcija je pogotovo zanimljiva kada se uzme u obzir da osnovna tvrdnja nije tačna: ljudi ne potiču od majmuna, i teorija evolucije to ne tvrdi. Evolucija čoveka je mnogo složenija, zanimljivija i duža priča nego što mnogi ljudi misle.
    Cilj ovog teksta je da iscrta opšti tok poznatog dela evolucije čoveka, da pokaže šta naučnici znaju, šta se pretpostavljaju, a šta još uvek ne znaju.
    Pre nego što počnemo da, korak po korak, razmatramo poznate podatke o evoluciji čoveka, objasnićemo nekoliko osnovnih pojmova o fosilima i paleontologiji i dati pregled opšteg toka razvoja koji je doveo do modernih ljudi. Nakon ovoga, pozabavićemo se svakom glavnom vrstom na putu do modernog čoveka; i konačno, vratićemo se na još jedan opšti pregled, da povežemo sve delove u celinu.


    a) Fosili


    Kosti sporije trunu nego ostatak tela, pa mnogi ljudi misle da kosti traju jako dugo; istina je, međutim, da se pod uobičajenim uslovima kosti potpuno raspadnu u roku od nekoliko godina. U suvim područjima ovo može trajati duže, a u slučaju kada su kosti zaklonjene i potpuno izolovane od vode (recimo, u kamenom sarkofagu), one mogu trajati hiljadama, pa i desetinama hiljada godina. Neke kosti naših predaka su očuvane upravo na ovaj način, što omogućava njihovu detaljnu analizu. Recimo, neke kosti Neandertalaca su tako dobro očuvane, da su naučnici iz njih uspeli da izdvoje DNK i da na osnovu poređenja sa uzorkom DNK modernog čoveka obore teoriju po kojoj su se Neandertalci stopili sa modernim ljudima.

    Ipak, kosti stare više od nekoliko desetina hiljada godina počinju da se raspadaju same od sebe čak i u potpuno suvim uslovima i ubrzo se pretvore u prah. Jedini poznati način na koji ove stare kosti mogu biti očuvane jeste proces fosilizacije. U ovom procesu, duboko zakopane kosti bivaju mineralizovane: proteini kostiju bivaju zamenjeni neorganskim mineralima, koji tokom kristalizacije zauzimaju prostor u kome se nalazila kost. Ovim fosil doslovno postaje parče kamena u obliku kosti. Fosili se datiraju pre svega radiometrijskim metodama; kombinacija tri metoda radiodatiranja daje datum fosilizacije na osnovu koga se može odrediti u kom periodu je fosilizovano biće živelo.

    Arheologija nalaza je takođe važna. Ako su fosili nađeni u istom sloju kao i ostaci vatre, recimo, ili ostaci kamenog oruđa, ti predmeti se takođe mogu datirati i na njih se može nešto naučiti o kulturi naših predaka i načinu njihovog života.

    Zatim, tu je morfološka analiza. Oblik i položaj kostiju, oblik lobanje, zapremina mozga, i mnogi drugi parametri pažljivo se mere i interpretiraju. Na osnovu ovih merenja se uspostavljaju parametri: kako je naš predak hodao, kakvo mu je bilo držanje tela, kako je izgledalo lice, itd.
    Konačno, na osnovu datiranja, morfologije i arheoloških nalaza, naučnici pokušavaju da reše zagonetku čovekovog nastanka. Ovaj posao je veoma težak i neizvestan, mada je danas mnogo lakši nego što je bio pre pedeset godina. Masa novih fosilnih nalaza, kao i unapređene, preciznije metode datiranja i analize organskih ostataka, omogućili su značajan napredak...

    b) Prvi pogled na stablo razvoja čoveka


    Pre nego što počnemo da se bavimo pregledom pojedinačnih vrsta i da sistematizujemo koja vrsta je postojala u kom periodu vremena, vredi pogledati par slika. Prvo, pogledajmo kakva je tačno veza između ljudi i ostalih primata:




    Kao što se može videti, stablo ljudske vrste je veoma razgranato i ne nalikuje direktnoj liniji koja vodi od majmuna do modernog čoveka. Za opis celog stabla bilo bi potrebno napisati nekoliko knjiga; u okviru ovog teksta, usredsredićemo se na poslednji deo grananja, koji sadrži tri generalne grupe.

    Prvu grupu čine Ardipithecus i njegovi rođaci, o kojima ne znamo skoro ništa osim da su postojali. Drugu grupu čine sami Australopitekusi, što uključuje i jednu grupu njihovih predaka, Parantropuse. Treću grupu čini genus Homo, koji obuhvata naše neposredne pretke, praljude koji su govorili jedni sa drugima i koristili alatke u svojoj borbi za opstanak.

    Iz ove slike, međutim, stvari i dalje izgledaju mnogo jednostavnije nego što jesu - čini se kao da su nam majmuni “iza ćoška”. Zato bi bilo dobro da pogledamo još jednu sliku na kojoj se vidi raspored fosila pomenute tri grupe kroz vreme:




    (Slika adaptirana iz teksta Džima Folija o evoluciji hominida, koga možete videti ovde.)

    Treba imati u vidu da ova slika ne pokazuje koja vrsta iz koje sledi, već samo starost fosila, i njihove najosnovnije osobine. Pogledajmo sada detaljno ove fosile, idući od najstarijih prema najnovijima...
    II Magloviti početak

    Kreacionisti često pričaju kako biolozi izvlače krupne zaključke na osnovu komadića kostiju, ili čak pojedinačnih zuba; ova priča nije tačna – kao što se može videti iz daljeg teksta, naučnici danas raspolažu značajnim brojem veoma potpunih fosila gotovo svih koraka našeg razvoja od prvih Australopitekusa do danas.

    Vredi pokazati, međutim, šta se može zaključiti i iz nepotpunih fosila. Za primer, uzmimo tri fosila koji se nalaze u najranijem periodu ljudske evolucije...

    Prvi je Sahelanthropus tchadensis, koji nam je poznat na osnovu jedne lobanje i nekoliko delimičnih vilica i zuba, star između šest i sedam miliona godina (fosil je pronađen 2002. godine). Lobanja je tipična za hominide, sa malim mozgom od oko 350 kubnih centimetara (ljudski mozak ima prosečnu zapreminu od oko 1500 cm3), i mnogim drugim osobinama sličnim današnjim šimpanzama. Ali tu je i nekoliko osobina tipičnih za ljudske lobanje, uključujući i daleko manje očnjake nego što je uobičajeno za majmune.

    Drugi je Orrorin tugenensis (pronađen 2001.), star šest miliona godina. Sve što imamo od ove vrste jesu delovi kostiju ruke i nogu, kao i ostaci donje vilice. Iako je i dalje očigledno veoma srodan šimpanzi, Ororin je imao zube slične čovekovim, a kosti nogu ukazuju da je, makar deo vremena, hodao na dve umesto na četiri noge.

    Treći je Ardipithecus ramidus, otkriven 1994, i najbolje istražen od sva tri pomenuta fosila. Star oko 5,5 miliona godina, Ardipitekus nam je poznat iz oko 45% kompletnog skeleta, i više fragmentarnih lobanja i udova. Oblik zuba je tačno na sredini između zuba šimpanze i ljudskih zuba, osim jednog zuba kod jednog mladog primerka, koji je sličniji zubima šimpanze nego bilo koji drugi zub daljih hominida. Kosti nogu pokazuju da je Ardipitekus najverovatnije bio dvonožac.

    Šta naučnici zaključuju iz ove tri grupe fosila?

    Sahelantropus nam ne govori mnogo. Možda se radi o stvarnom primerku prelaznog fosila, ali možda je reč i o nekoj izumrloj vrsti majmuna. Jedini razlog zbog koga je ovaj fosil važan je to što znamo da je vrsta postojala i znamo gde je otprilike živela, a to nam omogućava da usmerimo dalju potragu za fosilima i možda jednog dana nađemo potpunije fosile, od kojih možemo više da naučimo. S obzirom da je fosil otkriven tek nedavno, potraga je tek u začetku...

    Ororin nam govori malo više. Ako ništa drugo, znamo da je postojala vrsta velikih majmuna koji su hodali na dve noge i mogli da stoje uspravno. Da li je on bio jedan od naših predaka? Možda jeste, a možda i nije – odgovor će morati da sačeka dok se ne budu našli kompletniji fosili.

    Dva nova otkrića su nedavno proširila ovu oblast. Prvo su krajem 2004. nađeni fosili još devet jedinki Adripitekusa, koji podržavaju prethodne zaključke, i čine skoro potpuno sigurnom teoriju da su pripadnici ove vrste hodali uspravno.

    Drugo otkriće su ostaci hominida nađeni u Etiopiji u martu 2005. U trenutku pisanja ovog teksta detalji još nisu bili objavljeni, osim da se radi o skeletu starom oko četiri miliona godina. Po preliminarnim komentarima naučnika, moguće je da se radi o prelaznom obliku između Adripitekusa i kasnijih formi.

    Uzet sam po sebi, Ardipitekus ne govori mnogo; ali ako se uporedi sa fosilima Australopitekusa (o kojima govori sledeće poglavlje ovog teksta), možemo mnogo toga naučiti. Pošto imamo nekoliko različitih fosila, znamo da nije naprosto reč o jednoj jedinki koja je bila deformisana – radi se o izumrloj vrsti koja je najverovatnije hodala uspravno, imala zube koji su ličili na zube Australopitekusa, i čija lobanja pokazuje mnoge osobine koje su tipično ljudske. Mada još uvek nije sigurno da su Ardipitekusi bili među našim precima, oni su sasvim sigurno bili bliski rođaci naših dalekih predaka.

    Sa jedne strane, to nije mnogo podataka; ali sa druge strane, ako uzmemo u obzir koliko malo imamo, prikupili smo mnoštvo podataka. Šta se onda događa kada imamo kompletne fosile?
    III Australopithecus i Paranthropus

    Australopitekusi obuhvataju više vrsta, od kojih je jedna i A. afarensis, naš najverovatniji davni predak. Pogledajmo za trenutak stablo razvoja Australopitekusa, i njihovih izumrlih potomaka, Parantropusa:



    Australopithecus anamensis je najslabije poznat od svih Australopitekusa. Imamo samo devet nekompletnih fosila starih oko četiri miliona godina, uglavnom kostiju nogu – dovoljno da znamo da to veoma primitivan Australopitekus, da je reč o dvonožcu, i da su zubi slični ljudskim. Ali ovo nije dovoljno da izvučemo dublje zaključke.



    Prava priča počinje sa Australopithecus afarensis, koji je najverovatnije među našim direktnim precima. Ova vrsta nam je poznata iz više desetina nalaza, uključujući nekoliko više od 90% kompletnih fosila, među kojima se nalazi čuvena “Lusi” – preko 70% kompletan skelet ženke A. afarensis.

    Mada su kreacionisti više godina tvrdili da se zbog Lusinih nepotpunih nogu ne može znati da li je A. afarensis hodao na dve noge, dalji nalazi (pogotovo fosili nađeni u Hadaru, Etiopija) definitivno su potvrdili da su ovi rani Australopitekusi hodali na dve noge.

    Lice afarensisa imalo je izbačenu vilicu, sličnu vilici šimpanze. Zubi su bili veoma slični ljudskim, sa mnogo manjim očnjacima nego kod ranijih primeraka. Karlica je prilagođena hodanju, a oblik femura (butne kosti) je takav da bi četvoronožno hodanje bilo veoma neprijatno za afarensise.




    Zapremina lobanje afarensisa je približno ista zapremini lobanje šimpanze i malo je verovatno da je afarensis bio znatno inteligentniji. Zašto je tako naizgled sporedan detalj, poput hodanja na dve noge, doveo do razvoja tako kardinalnog svojstva kao što je inteligencija? Svi viši primati imaju ruke kojima mogu da hvataju i drže predmete; međutim, upotreba ruku je veoma ograničena, pošto viši primati ne mogu da efikasno koriste ruke u pokretu – čim treba da potrči, šimpanza, recimo, mora da koristi svoje ruke za odupiranje i ravnotežu. Uspravni hod je dozvolio Australopitekusima da drže stvari u rukama dok hodaju, što im je omogućilo da razviju alatke koje su mogli da prenose sa mesta na mesto, da drže u rukama oružje za lov, i da mnogo svrsishodnije koriste tragove inteligencije koju su imali. Vrlo je verovatno da je upravo ovaj napredak bio ključan u razvoju razuma kasnijih potomaka afarensisa.

    Neki kreacionisti i danas insistiraju da je A. afarensis samo izumrla vrsta majmuna. Takvima preporučujemo da pogledaju skelet prikazan na slici, koji pokazuje afarensisa u hodu. Mada još ne čovek po razumu, afarensis je već hodao kao čovek, uspravno...




    Od otkrića potpunih skeleta do danas, urađeno je više rekonstrukcija izgleda afarensisa, od kojih je jedna prikazana ovde. Pri posmatranju ovakvih rekonstrukcija treba imati u vidu da je opšti izgled (pogotovo izgled vilice i očiju) verovatno tačan, ali da su mnogi detalji (boja kože, dlakavost) puko nagađanje.

    U savršenom primeru prelaznih fosila, afarensisa je nasledila mnogo razvijenija vrsta poznata kao Australopithecus africanus. Paleontolozi su dugo pretpostavljali da je afarensis bio direktni predak čoveka; međutim, noviji dokazi pokazuju da je afrikanus nasledio afarensisa, i da se negde kod afrikanusa (ili iz neke grupe između afarensisa i afrikanusa) desio veliki razlaz ljudske vrste. Sa jedne strane su se odvojili Paranthropusi, sa druge strane se odvojio genus Homo, čovek.
    Veza između vrsta se možda najlakše može videti ako uporedimo stopala i karlice šimpanze, afrikanusa, i modernog čoveka (Homo sapiens):



    Još zanimljivije je poređenje lobanja afarensisa, afikanusa i modernog čoveka:



    Kao što se može primetiti, lobanja je još uvek daleko od ljudske. Zapremina mozga je suviše mala, a kao što se vidi na lobanji Taung deteta (više od 90% kompletnog skeleta bebe afrikanusa) očnjaci su još uvek bili šiljati. Ali, oblik lobanje je već počeo da se menja i povećava, prateći rastuću inteligenciju Australopitekusa.

    Ovde je počela da se događa još jedna promena. Mužjaci većine primata mnogo su veći od ženki, što je bio slučaj i kod afarensisa (prosečna težina mužjaka afarensisa je bila oko 45 kg, prosečna težina ženke oko 29 kg). Kod afrikanusa, ova razlika počinje polako da se smanjuje – prosečan mužjak afrikanusa je bio težak oko 41 kg, prosečna težina ženke je bila oko 30 kg.

    Pre nego što pređemo na naše skorije i bliže rođake iz genusa Homo, trebalo bi makar baciti brz pogled na Parantropuse, granu praljudi koja je izumrla pre otprilike milion godina...

    Najranija i najmisterioznija vrsta Parantropusa je Paranthropus aethiopicus, od koje nam je ostala jedna delimična lobanja i nekoliko parcijalnih fosila. Zbog nedostatka podataka, nije sigurno da li je aethiopicus bio predak kasnije vrste Paranthropus robustus, ili je ona nastala direktno od afrikanusa. Veoma je verovatno, međutim, da je treća vrsta Parantropusa, Paranthropus boisei, nastala od aethiopicusa.



    Svi Parantropusi imaju neke zajedničke osobine: debela i čvrsto građena lobanja sa tipičnom koščatom “krestom” na vrhu, kao i masivna vilica sa velikim i snažnim zubima. Zapremina mozga je malo veća nego kod ranijih Australopitekusa, i neki arheološki nalazi pokazuju da je vrlo verovatno da su Parantropusi koristili slomljene kosti kao alatke za kopanje.

  11. #26

    Odgovor: Teorija evolucije ili kreacionizma

    IV Rani Homo

    Pre oko 2.3 miliona godina, jedna grupa australopitekusa je napravila veliki skok u tehnologiji: umesto korišćenja kostiju ili kamenja koje bi uspeli da nađu, pripadnici ove grupe su počeli da sami proizvode svoje alatke.

    Proizvodnja alata podrazumeva sposobnost planiranja: neke grupe današnjih šimpanzi umeju da, kada nađu mravinjak, na brzinu od grane naprave prostu alatku za izvlačenje mrava iz njihovih podzemnih tunela. Međutim, nikada nije viđen nijedan šimpanza kako pravi takve alatke unapred, spremajući se za lov.

    Prva grupa praljudi koja je postigla ovaj napredak smatra se pravim početkom genusa Homo, istinskim ljudima. Pre nego što počnemo priču o njima, pogledajmo stablo razvoja na osnovu svih podataka koje imamo do danas:



    Prva vrsta otkrivena zajedno sa ostacima oruđa i tragovima upotrebe tog oruđa jeste Homo habilis. Znatno kasnije su otkriveni tragovi vrste slične habilisu, mada sa značajnim razlikama u strukturi lobanje. Ova vrsta je nazvana Homo rudolfensis, mada još uvek nije sigurno da li je reč o posebnoj vrsti, ili tek o malo drugačijoj grupi habilisa. Za potrebe ovog teksta, koristićemo reč “habilis” da označimo obe ove grupe.



    Na slici se vidi da je lobanja habilisa u nekoliko detalja različita od lobanje afrikanusa. Zanimljiv je prvi znak smanjenja veličine vilice, i njene manje isturenosti; zapremina mozga je samo malo veća nego kod Australopitekusa. Karlica i leđa habilisa su bolje prilagođena uspravnom hodanju, tako da ovde već nestaju svi tragovi povijenosti. Zubi su manji, što ukazuje da je habilis jeo mekšu hranu – rezultat sečenja hrane alatkama, što je zamenilo kidanje zubima.





    Ono što je možda najveća i najvažnija razlika u odnosu na Australopitekuse uopšte nije vidljivo spolja, već se može primetiti tek pomoću skeniranja unutrašnjosti lobanje. Naime, deo mozga koji kontroliše govor, takozvano Broka područje, nalazi se ispod veoma specifične izbočine na mozgu koja se uklapa u odgovarajuće udubljenje na lobanji. Nijedan od živih primata nema ovo udubljenje, niti su ga imali Australopitekusi i Parantropusi – ono se prvi put javlja kod habilisa. Znači, Homo habilis je bio prvi predak modernog čoveka koji je imao sposobnost govora! Ova sposobnost je verovatno bila prilično rudimentarna i ograničena, pošto ostaci vrata i veze kičme sa lobanjom pokazuju da je habilis verovatno imao vrlo primitivne glasne žice. Međutim, ova sposobnost, kada se jednom pojavila, relativno je brzo evoluirala, kao što ćemo videti u daljem tekstu.

    Prvi pripadnici roda Homo živeli su (koliko znamo) u jugoistočnom delu Afrike. Njihove alatke su bile veoma primitivne, uglavnom sačinjene od kamenja koje su lomili na takav način da lomljenje ostavi oštru ivicu. Pošto su prvi tragovi ovakvog oruđa nađeni u Olduvaiu, prva ljudska tehnologija se zove “oldovanska”. Primer jedne oldovanske alatke prikazan je na priloženoj slici.


  12. #27

    Odgovor: Teorija evolucije ili kreacionizma

    V Homo ergaster



    Poslednji deo ljudskog stabla predstavlja savršenu tranziciju. Mozak polako raste, vilica postaje sve manje izbačena, glasni aparat se sve više razvija, zubi postaju sve manji...

    Promene su toliko glatke da postoji određena doza neslaganja među naučnicima u vezi sa tim da li su kasniji primerci i dalje deo vrste Homo ergaster, ili je reč o ranim primercima vrste Homo erectus. Dobar primer ove kontroverze je jedan od najkompletnijih fosila ergastera, “Dečak iz Turkane” (na slici), koga neki svrstavaju u ergastere, a neki u erektuse.

    Otkud neslaganje? Rani primerci ergastera imaju zapreminu lobanje od oko 700cm3 – oko 150cm3 više nego Homo habilis. Sledeći primerci ergastera kojima raspolažemo imaju zapreminu mozga od oko 850 cm3, dodatak od još 150 cm3, koji pokazuje naglu evoluciju inteligencije. Konačno, najrazvijeniji primerci ergastera dostigli su više od 900 cm3, što je na nivou ranih primeraka Homo erectusa. Kranijalni fleksus, deo vrata koji oslikava razvoj govornog aparata, takođe pokazuje stalni razvoj.

    Drugim rečima, imamo dovoljno fosila da pratimo evoluciju iz koraka u korak, da posmatramo kako se jedna vrsta pretvara u drugu; što samo po sebi dovodi do pitanja na kom mestu tačno treba povući liniju i reći da se tu nalazi granica između dve vrste...

    Jedini način da steknemo realnu sliku ljudske evolucije jeste da posmatramo ergastera i erectusa kao jedan kontinuum. Analiza fosilnih karakteristika nam govori da je negde u toku prelaza između ergastera i erectusa, možda baš u vreme kada je dečak iz Turkane živeo, došlo do sledeće velike podele ljudske rase. Jedna grupa je ostala u Africi i nastavila je da živi tamo do sledeće velike klimatske promene; ovu grupu čine naši direktni preci, arhaični Homo sapiens (alternativno nazvan Homo heidelbergensis). Druga grupa je izašla iz Afrike i naselila veći deo južne Evrope i Azije; ova, danas izumrla grupa, nazvana je Homo erectus, uspravni čovek.

    VI Homo erectus



    Homo erectus je istorijski najuspešnija grana ljudske vrste. Naša vrsta, Homo sapiens sapiens, postoji tek nekih dve stotine hiljada godina. Erectus je vladao dobrim delom sveta skoro 750,000 godina.
    Od svih ljudskih predaka, Homo erectus je najbolje poznat nauci – preko dve stotine fosila je nađeno do danas na području od Španije do Kine, zajedno sa njihovim oruđem, tragovima lova, ishrane, načina života...



    Na osnovu ovog obilja arheoloških podataka, zna se da je erektus bio mnogo bolji lovac nego prethodni ljudi (koji su najverovatnije bili većinom skupljači plodova). Iz razvijenog mozga i tragova razvijenog govornog aparata znamo da je imao i relativno dobru sposobnost komunikacije. Ubojitost i efikasnost erektusa u lovu se dodatno povećala pre oko 1.200.000 godina, kada je došlo do sledećeg velikog skoka u razvoju tehnologije: prelaska na korišćenje vulkanskog kamena za oruđe, i izrade dvoseklih sekira. Ova tehnologija se naziva ačulejska, i neki primeri su prikazani na slici, zajedno sa principom proizvodnje ovakvih oruđa: erektusi su prvo grubo klesali kamen uz pomoć drugog, teškog i tupog kamena, pa zatim fino oblikovali oštricu mekim “čekićem” od kosti.



    Korišćenje oruđa i razvoj alata bili su plodovi erektusove inteligencije, ali su takođe vodili ka daljem pritisku za razvoj ove inteligencije: rani primerci erektusa imaju zapreminu lobanje od oko 850 cm3, dok poslednji primerci koje imamo dostižu i do 1200 cm3, što se preklapa sa nižim rangom zapremina mozga kod modernog čoveka!

    Kako je erektus izgledao? Njegova vilica je i dalje bila izbačenija nego vilica modernog čoveka, a takođe je još uvek bio prisutan takozvani supraorbitalni torus, tipično izbačeno čelo. Zubi su bili veoma slični čovekovim, ali i dalje veći, sa većim očnjacima. Rekonstrukcija verovatnog izgleda erektusa je prikazana na slici.




    Pre otprilike 400.000 godina, erektus je napravio poslednji veliki skok, savladavši upotrebu vatre. Međutim, upravo u ovom periodu, nova vrsta, potomci erektusa iz Afrike, počela je da se širi kroz Evropu i Aziju. Homo sapiens, moderni čovek, konačno je stupio na scenu. Njegov dolazak, uz njegovu modernu tehnologiju i veću inteligenciju, predstavljao je kraj erektusa. Mada je moguće da su izolovane grupe preživele još stotinama hiljada godina (možda čak i do samo dvadesetak hiljada godina pre naše ere), u roku od sto hiljada godina, novi osvajači su preuzeli najveći deo teritorija kojima je erektus nekada vladao.

    VII Homo sapiens

    Danas postoji samo jedna vrsta genusa Homo, i mi tu vrstu zovemo “čovek”. U prethodnom tekstu smo videli da se ova vrsta najverovatnije odvojila od erektusa negde u toku prelaza ergaster-erektus. Kao što je uobičajeno u evoluciji, nije dugo bila reč samo o jednoj vrsti. U okviru ove diskusije, važne su tri vrste, ili podvrste: prvi, arhaični Homo sapiens, takođe poznat kao Homo heidelbergensis; i dve podvrste na koju se ova originalna vrsta podelila, moderne ljude, Homo sapiens sapiens, i neandertalce, Homo sapiens neanderthalensis.



    Arhaični sapiensi su poznati na osnovu nekih šezdesetak fosila, starih između 800 i 400 hiljada godina. Posedovali su mnoge osobine slične erektusu, ali znatno sličnije modernim ljudima. Prosečna veličina mozga je bila oko 1200 cm3, veća nego kod erektusa ali manja nego kod modernih ljudi. Lobanja je postala zaobljenija nego kod erektusa, zubi manje izraženi, i vilica uvučenija. Mnogi primerci, pogotovo stariji, i dalje imaju izražene koščate izrasline iznad obrva, sa čelom nagnutim unazad. U još jednoj savršenoj evolutivnoj tranziciji, razlika između erektusa i ranih arhaičnih sapiensa je minimalna i teško je povući liniju između dve vrste.

    Arhaični sapiensi su se podelili na dve grupe koje su donekle postale različite. Sa jedne strane su stajali naši preci i naša današnja rasa. Sa druge strane bili su neandertalci.



    Neandertalci su živeli između 230.000 do 30.000 godina p.n.e; veoma su dobro proučeni, pošto do danas imamo preko četiri stotine njihovih fosila i ostataka. Bili su nešto niži, ali zato znatno širi i fizički snažniji nego moderni ljudi. Lobanje su im bile izduženije nego kod modernih ljudi, sa izbačenom vilicom i sredinom lica, ali i dalje sa nagnutim čelom. Donja vilica je obično bila uvučena u poređenju sa sredinom lica. Većina razlika između neandertalaca i modernih ljudi bila je upravo u građi lobanje; ostale kosti su uglavnom iste, sa izuzetkom ramena i neobičnog oblika nekih od kostiju karlice.

    Na slici možete videti rekonstrukciju izgleda neandertalca (kao i kod prethodnih rekonstrukcija, boja kože, kao i dužina i raspored dlaka su nagađanje). Obratite pažnju na dug, pljosnat nos, nagnuto čelo, i uvučenu vilicu.

    Skeleti neandertalaca često pokazuju tragove lomljenja i ponovnog zarastanja kostiju, znak da je njihov život bio veoma težak i surov. Ipak, činjenica da su ljudi sa polomljenim kostima uspevali da prežive dovoljno dugo da te kosti zarastu, ukazuje da su neandertalci živeli u grupama u kojima su članovi podržavali jedni druge.

    Suprotno nekim ranim idejama koje se i dalje ponekad mogu naći u knjigama, neandertalci su bili visoko inteligentni – vrlo verovatno isto onoliko koliko i naši preci. Od njih počinje treća era razvoja kamenog oruđa, takozvana Musterijanska tradicija, a zna se da su bili veoma dobri i organizovani lovci koji su bili u stanju da uhvate mnoge velike i opasne zveri. Živeli su često u blizini ivica glečera tadašnjeg ledenog doba, i bili su veoma uspešni u preživljavanju u takvim hladnim i oskudnim uslovima.



    Za razliku od naših predaka, neandertalci verovatno nisu imali tradiciju umetnosti, pošto do danas nisu otkriveni nikakvi tragovi njihovih slika ili dekoracija. Međutim, postoje tragovi da su verovali u život posle smrti, pošto su farbali svoje mrtve crvenim prahom, posipali ih određenim vrstama cveća, i ponekad sahranjivali zajedno sa ritualnim predmetima.

    VIII Opšti pregled

    I tako smo stigli do Homo sapiens sapiens, modernog čoveka, vrste kojoj pripada kako pisac ovog teksta, tako i svi čitaoci. Ostalo nam je još samo da povežemo sve prethodno rečeno u jednu celinu.

    Prvi korak u razvoju je pojava dvonožnog hodanja. Osim po ovoj osobini, rani australopitekusi nisu bili mnogo različiti od svojih majmunolikih predaka; da su preživeli do danas, ljudi bi ih verovatno smatrali uspravnim majmunima. Dvonožno hodanje je bilo najpre primitivno, ali se veoma brzo razvilo do današnjeg nivoa; već kod Homo habilis su noge i kičma postali praktično onakvi kakvi su i danas kod modernih ljudi.

    Razvoj mozga je bio druga priča. Mada veličina mozga nije merilo inteligencije, generalni rast zapremine mozga jeste pratio razvoj oruđa i upotrebe tog oruđa kroz istoriju, tako da neki nivo korelacije postoji.

    Pogledajmo tabelu:

    vrsta raspon -veličine mozga (cm3)- prosek veličine mozga (cm3)

    šimpanza 300-500 -
    australopitekusi 400-530 -
    Homo habilis 500-750 - 631
    Homo erectus 800-1250- 1000
    neandertalci 1300-1750- 1400
    moderni čovek 900-2300- 1345


    Može se videti kako se mozak razvijao korak po korak. Skeleti i lobanje pokazuju sličan gradualni razvoj, savršeni evolutivni prelaz od jedne vrste ka sledećoj. Ostalo je još samo jedno pitanje: zašto su ljudi danas jedini preživeli članovi naše familije?

    Naši dalji rođaci, šimpanze, žive kao skupljači u džungli, za koju su mnogo bolje prilagođeni od nas. Između ljudi i šimpanzi nikada nije postojao direktan sukob. Ali sukob jeste postojao između ranih ljudi i australopitekusa: živeli su na istim područjima, hranili su se sličnom hranom, i koristili slične resurse. Prvi ljudi, naoružani svojim novim kamenim oruđem i većom inteligencijom, su prvo potisnuli australopitekuse, da bi ih zatim i istrebili. Ovaj proces nije bio brz – od nastanka prvih ljudi, do nestanka zadnjih parantropusa je prošlo skoro milion i po godina – ali je bio nezaustavljiv.
    U nekom smislu,australopitekusima je odzvonilo u trenutku kada je prvi Homo habilis dohvatio polomljeni kamen i pomislio “hej, ovim mogu da sečem meso”.

    Sa kasnijim ljudskim vrstama, situacija je malo komplikovanija. Postoje dva osnovna modela razvoja: model zamene, i model regionalnog kontinuiteta.


    Po modelu zamene, ljudi su se odvojeno razvijali na tri kontinenta, da bi ih onda moderni Homo sapiens sve potisnuo u svom širenju. Po modelu regionalnog kontinuiteta, stalno je postojala genetska migracija između različitih delova, tako da je ljudska rasa na planeti evoluirala kao jedna velika masa.

    Istina je verovatno negde na sredini, mada je nagnuta ka modelu zamene. Fosilni i anatomski dokazi pokazuju da je određena količina ukrštanja postojala do razvoja arhaičnog Homo sapiensa, ali da je posle toga najverovatnije došlo do zamene: nova, inteligentnija vrsta je potisnula erektuse, i na kraju ih istrebila.

    Direktnije dokaze imamo u vezi sa načinom na koji su neandertalci nestali. Mada postoje neki tragovi ukrštanja neandertalaca i modernih ljudi (nekoliko skeleta modernih ljudi sa nekim neandertalskim osobinama), genetski dokazi ukazuju na nesrećniju priču. Naime, neke kosti neandertalaca su toliko dobro očuvane da su naučnici iz njih uspeli da izvuku mitohondrijalnu DNK, genetski materijal koji su onda mogli da uporede sa istim materijalom kod modernih ljudi. Pokazalo se da potomci neandertalaca nisu preživeli do danas u ljudskoj populaciji. Drugim rečima, najverovatniji scenario je da su naši preci, u svom širenju kroz Evropu, prvo potisnuli pa zatim i istrebili neandertalce.

    IX Dodatak: Homo floresiensis

    Samo par nedelja pre početka pisanja ovog teksta, objavljeno je otkriće nove vrste u okviru genusa Homo. Patuljasti skeleti nađeni na ostrvu Flores u Indoneziji imaju neke neverovatne osobine, među kojima je i struktura kostiju nogu slična Homo erektusu. S obzirom da su fosili stari tek nekih 18,000 godina, ovo bi značilo da je makar jedna izolovana grupa erektusa uspela da preživi znatno duže nego što se ranije znalo, čak duže nego neandertalci.



    Ovi nalazi se sada nalaze pod lupom intenzivnog naučnog istraživanja, i verovatno će biti potrebno par godina pre nego što se o njima bude moglo reći išta definitivno. Kada detaljniji podaci postanu dostupni, ovaj tekst će biti dopunjen da uključi i te informacije.

  13. #28

    Odgovor: Teorija evolucije ili kreacionizma

    Ako tebi Lebe ne smeta, zamolila bih moderatora da uradi split na 26. postu i ubaci, po mom mišljenju bitno:
    Kako se vrše genetska poređenja, i kako se promene prate iz vrste u vrstu?

    Većina mutacija je neutralna. Međutim, neutralne ili ne, mutacije će biti nasleđene...što znači da će vrste koje se odvoje od početne imati istu tu mutaciju u svom genetskom kodu. Ovo je lakše objasniti uz pomoć slike:



    Od početne vrste, odvajaju se nove, svaka sa svojim mutacijama. Svaka vrsta nasleđuje kod svog prethodnika, i unosi svoje izmene. Prateći koje baze ostaju iste, a koje se menjaju i kako, može se izgraditi stablo predaka.

    Ova shema ocrtava idealan slučaj genetske analize. U stvarnosti, sheme su daleko komplikovanije, pra-vrste su izumrle i njihov genetski kod više nemamo, i broj mutacija od vrste do vrste je veći i teži za praćenje. Zato se za proizvodnju ovakvih shema koriste masivne statističke analize, u kojima se prate promene na stotinama ili hiljadama gena paralelno.

    ____________


    Šta su to uopšte mutacije, i kako one funkcionišu? Zašto je većina mutacija neutralna?



    U svakoj modernoj živoj ćelliji na svetu se nalazi centralni kontrolni sistem, zapis na osnovu koga ćelija funkcioniše, na osnovu koga se razmnožava, i koji kontroliše njeno ponašanje. Ovaj kontrolni sistem se sastoji od DNK, deoksiribonukleninske kiseline.

    DNK sadrži informacije u vidu nizova baza: adenozina, timina, guanina i citozina, koji se najčešće označavaju skraćeno kao A, T, G i C. Nizovi ove četiri baze čine genetski kod, na osnovu koga život funkcioniše. Ovaj kod, kada se napiše slovima, obično izleda kao dugačak, besmislen niz slova: ATGCCTAAATCTG...

    Na nekim mestima u ovom nizu “slova”, međutim, pojavljuju se specijalne oznake, obično u vidu posebnih sekvenci poznatih kao promoteri. Primer promotera je sekvenca ATG desetak baza nakon sekvence TATAAT. Ovakve specijalne sekvence označavaju aktivne delove DNK, poznate pod nazivom geni, i ti aktivni delovi su zaista važan deo celog sistema.

    Ali kako se od gena, prostih nizova baza na DNK, dolazi do konačnog produkta, ćelije? Da bi smo ovo razumeli, moramo prvo da znamo još nešto o ćelijskoj hemiji. Ako zamislimo DNK kao “arhivu” u kojoj su pohranjene informacije o tome kako ćelija treba da radi i da se razmnožava, radnici koji obavljaju sav posao – čitaju informacije iz arhive, prave ćelije, dele ih, izvode sve procese koji su ćeliji potrebni da preživi – pripadaju drugoj klasi velikih molekula, poznatoj kao proteini.

    Proteini su, po organizaciji, donekle slični DNK. Isto kao što je DNK lanac četiri osnovna sastojka koja se ponavljaju u različitim kombinacijama, proteini su lanci istih sastojaka...s tim što se proteini umesto četiri sastoje od dvadeset osnovnih delova, amino-kiselina. Svaka od ovih dvadeset amino-kiselina ima svoje posebne osobine, i njihove kombinacije omogućavaju proteinima da budu veoma fleksibilni i da obavljaju sve raznovrsne hemijske procese potrebne za opstanak života.

    Svaki gen u okviru DNK sadrži informaciju o jednom određenom proteinu. Proteini nastaju na osnovu gena, i geni deluju tek kroz proteine napravljene na osnovu njih. Ako to razumemo, možemo da opišemo put od DNK do proteina:

    Gen prvo prolazi kroz proces transkripcije. U ovom procesu, DNK lanac se razdvaja na dva dela, i jedna strana biva iskopirana u kraću sekvencu veoma slične kiseline, poznate kao ribonukleinska kiselina (RNK). Ovaj novostvoreni RNK lanac, za razliku od ogromnog lanca DNK, sadrži samo jednu informaciju: kako napraviti jedan određeni protein. Takodje, u lancu RNK, baza timin (T) biva zamenjena jednom drugom sličnom bazom, uracilom (U).

    Nakon što je gen iskopiran u RNK, sledi proces translacije. RNK lanac odlazi do kompleksnog skupa molekula, ribozoma. Ribozom “čita” RNK lanac, i na osnovu RNK koda proizvodi novi protein. Pošto RNK, isto kao i DNK, ima samo četiri baze, potreban je određeni kod da bi se pomoću četiri slova mogao izraziti proteinski niz koji, setimo se, može imati bilo koju kombinaciju dvadeset amino-kiselina. Zbog ovoga, genetski kod je troslovan: svake tri baze u lancu RNK označavaju po jednu amino-kiselinu u novom proteinu.

    Ovo je lakše razumeti na primeru. Zamislimo da se na DNK nalazi veoma kratak gen sa sledećom sekvencom:

    ATGGTGCCTAATATTAGCTAG

    Ovo će prvo kroz proces transkripcije biti prevedeno u RNK lanac sa sekvencom:

    AUGGUGCCUAAUAUUAGCUAG

    Ribozom će ovo citati tri po tri baze, i prevesti u niz amino-kiselina

    AUG GUG CCU AAU AUU AGC UAG
    Met Val Pro Asn Ile Ser Stop

    Troslovne oznake (Val, Pro...) su simboli za određene amino-kiseline (valin, prolin...itd.). Zadnja tri slova, UAG, čine tzv. stop kodon, koji daje signal ribozomu da na tom mestu treba da prestane sa daljom sintezom proteina. Ova ilustracija pokazuje kako bi se od kratkog niza DNK mogao proizvesti kratak protein, koji onda može da obavlja nekakvu funkciju u okviru ćelije.

    Za razliku od ovog našeg primera, naravno, stvarni proteini su daleko veći. Na primer, keratini, proteini od kojih su najvećim delom sačinjene naše dlake i nokti, su preko 300 amino-kiselina dugački, što znači da su geni na osnovu kojih su sačinjeni dugački više od 1200 baza. Najveći poznati protein, titin, se sastoji od neverovatnih 28000 amino-kiselina!
    Šta su onda mutacije?

    Mutacije su promene u genetskom kodu, do kojih može doći na mnoge načine. Svaki put kada se ćelija deli, recimo, DNK mora biti iskopirana u dve kopije, po jedna kopija za svaku novu ćeliju. Mada je ovo kopiranje veoma precizno, ono ipak nije savršeno – otprilike na svakih milijardu tačno iskopiranih baza, jedna biva pogrešno prenesena. Drugi izvor su oštećenja na DNK, do kojih može doći spontano kroz normalan život ćelije, ili kroz spoljne otrove ili negativne uticaje (ultraljubičasto zračenje, na primer). Kroz evoluciju, ćelije su razvile veoma kompleksan sistem za popravku promena na DNK, ali ovi sistemi ne samo što imaju ograničenja, već ponekad umeju da i sami izazovu dodatne greške.

    Konačno, jedna čitava klasa virusa, takozvani retrovirusi, igra veoma značajnu ulogu u mutacijama na DNK. Ovi virusi ne samo što inficiraju ćelije, već sadrže proteine zvane integraze, kkoji im omogućavaju da svoje gene upišu direktno na DNK same ćelije. Tako geni virusa postaju deo genetskog sklopa samog organizma, i mogu ostati u tom sklopu praktično zauvek.

    Mada ovo na prvi pogled može izgledati kao nevažna stvar, bar što se genetike tiče, retrovirusi su u stvari igrali ogromnu ulogu u razvoju života na zemlji. Izgleda neverovatno, ali najveći deo ljudske DNK ne čine naši geni...već ostaci retrovirusa koji su se kroz milijarde godina integrisali u naš organizam, postajali neaktivni kroz mutacije, i prosto bivali kopirani iz generacije u generaciju zajedno sa aktivnim delom našeg genetskog koda. Najpoznatiji i najzloglasniji retrovirus današnjice je HIV, koji izaziva ljudsku imunodeficijenciju, poznatiju kao sida.

    Postoje razne vrste mutacija, od kojih ćemo ovde radi ilustracije pomenuti dve osnovne varijacije.

    Prva vrsta su takozvane point-mutacije, u kojima dolazi do promene jedne baze u genetskom kodu. Kao što će biti objašnjeno u daljem tekstu, ova vrsta mutacija ponekad ne izaziva nikakvu promenu u organizmu uopšte, ali ponekad može da bude veoma značajna. Primer pozitivne point mutacije je nedavno otkrivena point mutacija na jednom regulatornom genu, koja postoji u severnoj Italiji, među naslednicima čoveka kod koga se ona originalno dogodila. Ljudi koji nose ovu mutaciju imaju značajno manje šanse da dožive infarkt ili srčani udar, pošto se njihove arterije automatski čiste mnogo bolje nego kod ostalih ljudi. Primer negativne point mutacije su relativno česti problemi sa mutacijama na proteinu kolagenu, koje dovode do deformacija kostiju kod dece.

    Druga vrsta su takozvane frejmšift (frameshift) mutacije, u kojima baza biva ubačena ili izbrisana. Ove mutacije su obično mnogo radikalnije od point-mutacija, pošto potpuno menjaju strukturu proteina. Pogledajmo razliku između point i frejmšift mutacija na našem malom genu koga smo pomenuli ranije. Originalni gen izgleda ovako:

    Gen: AUG GUG CCU AAU AUU AGC UAG
    Protein: Met Val Pro Asn Ile Ser Stop

    Zamislimo sada da se desi jedna point mutacija u kojoj jedan citozin bude zamenjen, recimo, adeninom. Rezultat će biti sledeći:

    Gen: AUG GUG ACU AAU AUU AGC UAG
    Protein: Met Val Thr Asn Ile Ser Stop

    Point mutacija je promenila CCU, kod za amino-kiselinu prolin, u ACU, kod za amino-kiselinu treonin. Ovo može, ali ne mora, uticati na funkciju čitavog proteina. Frejmšift mutacija na istom mestu, međutim, ima daleko veće posledice:

    Gen pre mutacije: AUG GUG CCU AAU AUU AGC UAG
    Gen nakon mutacije: AUG GUG CU AAU AUU AGC UAG
    Citanje gena: AUG GUG CUA AUA UUA GCU AG?
    Protein: Met Val Leu Ile Leu Ala ...

    U ovom slučaju, citozin je prosto izbrisan iz genetskog koda...što je izazvalo da se sve kombinacije nakon toga (setimo se, ribozom čita kod tri po tri slova) promene. Sastav proteina nakon mesta brisanja je potpuno promenjen! I ne samo to, već je stop kodon, UAG, sada oštećen. Ako se u RNK nizu iza UAG nalazi još baza (za koje nije bilo predviđeno da budu prevedene), te baze će biti pročitane, i na osnovu njih će na protein biti dodato još amino-kiselina, što će dodatno promeniti njegovu strukturu i funkciju.
    Zašto je većina mutacija neutralna?

    Postoje dva osnovna razloga zašto je većina mutacija neutralna. Prvi od njih je što tri baze mogu da formiraju 64 različita koda, a pritom postoji samo dvadeset amino-kiselina. Rezultat ovoga je da više različitih kombinacija kodira istu amino-kiselinu.



    Kao što možete videti iz gornje tabele, neke amino-kiseline su kodirane samo jednim kodom (recimo, UGG je jedini kod za triptofan), ali većina ima tri, četiri, ili više kodova. Leucin, najčešća amino-kiselina, ima čak šest različitih kodova. Sa stanovišta mutacija, ovo ograničava njihov efekt značajno. Recimo, ako point mutacija proizvede promenu u genu iz CUU u CUC, to neće imati ama baš nikakav efekt, pošto oba kodiraju leucin, i proizvedeni protein će biti identičan.

    Drugi razlog je fleksibilnost proteina. Sve amino-kiseline koje čine protein se mogu grubo podeliti u tri grupe. Prvo, tu je nekoliko ključnih amino-kiselina, koje učestvuju direktno u hemijskim reakcijama kojima proteini upravljaju, i koje se zato ne smeju menjati praktično uopšte. Drugo, tu su amino-kiseline važne za strukturu, koje mogu da se menjaju donekle, dogod promena nije preterano velika (po naelektrisanju ili po veličini). Treću grupu čine “slučajne” amino-kiseline, koje prosto povezuju prethodno pomenute dve grupe u niz odgovarajuće dužine, i koje se mogu menjati praktično bez ograničenja, a da pritom protein ostane funkcionalan.

    U eksperimentalnim istraživanjima, naučnici su menjali i do 97% amino-kiselina u okviru nekih proteina, i uspevali da zadrže potpunu funkcionalnost.

    Koliko brzo se mutacije šire kroz populaciju?


    Veoma negativne se ne šire praktično uopšte, blago negativne se šire sporo, pozitivne se šire veoma brzo. Brzina širenja je, međutim, relativna stvar, zavisna od vrste, dužine života jedinke, dužine reproduktivnog ciklusa, i mnogih drugih faktora.

    Zanimljivo merilo koliko se jedna mutacija može raširiti u populaciji počevši sa jednom jedinkom možemo dobiti iz širenja porfirije u Južnoj Africi. Porfirija je blago negativna mutacija, poremećaj metabolizma kod čoveka, koji nije dovoljno negativan da bude značajan utican na njegovu sposobnost da ostavi potomstvo. 1680 godine, bračni par Ariaantje i Gerrit Jansz emigrirao je iz Holandije u Južnu Afriku; jedno od njih dvoje je nosilo u sebi gen koji proizvodi porfiriju. Danas u Južnoj Africi živi više od 30,000 njihovih potomaka koji pate od bolesti, i još najmanje dva puta veći broj potomaka koji nose gen ali nemaju simptome. Čak i kod sporo-reprodukujuće vrste kao što su ljudi, hiljadu godina je dovoljno da jedna mutacija bude prenesena na stotine miliona jedinki. Kod vrsta koje se brže razmnožavaju, ovo širenje je još brže.
    Poruku je izmenio DrinChe, 28.09.2008 u 14:34

  14. #29

    Odgovor: Teorija evolucije ili kreacionizma

    Prelazni Fosili





    Sadržaj:


    1. Uvod – Šta su to prelazni fosili?

    Šta je cilj ovog teksta?

    Dok se tekst “Evolucija Čoveka” bavi fosilima koji pokazuju razvoj ljudi od primata, ovaj tekst će se koncentrisati na opisivanje evolutivnog puta od primitivnih jednoćelijskih organizama do primata. Ovo znači da će najveći deo evolutivnog stabla – evolucija riba nakon što su se od njih odvojili preci vodozemaca, evolucija vodozemaca nakon što su se od njih odvojili preci reptila, itd. – biti samo usputno pomenut.

    Razlog za ovo je veličina posla: u toku zadnjih par vekova, paleontolozi su iskopali bukvalno milione fosila, uključujući tu i desetine hiljada raznih prelaznih vrsta. Mogli bi smo ovde napisati čitave knjige, pa da opet ne uspemo da obradimo ni pola poznatih fosila.



    Pokušajmo da, za početak, ovom pitanju priđemo sa neutralne tačke. Zamislimo dvojicu paleontologa koji vrše iskopavanja u nekom nalazištu bogatom fosilima. Jedan paleontolog veruje da je teorija evolucije tačna, drugi paleontolog je kreacionista i veruje u doslovno stvaranje za šest dana.

    Počnu njih dvojica da kopaju, i u jednom dubokom sloju ubrzo nađu fosil koji ne liči ni na jednu danas postojeću vrstu. Po kostima se vidi da je životinja bila biljožder, srodna današnjim kopitarima. Na osnovu lobanje:




    ...naprave i rekonstrukciju kako je ova životinja verovatno izgledala. Slika potvrđuje da se radi o vrsti koja je znatno drugačija od svega što je danas poznato, mada u neku ruku liči na minijaturnog konja:




    Sa tačke gledišta evolucije, ovo je jedna od mnogih izumrlih vrsta koje su živele i nestale tokom zadnjih nekoliko miliona godina. Sa stanovišta kreacionizma, ovo je jedna od vrsta koje su nestale u zadnjih šest hiljada godina, najverovatnije u potopu. Znači, ni jedan ni drugi pristup nema problema sa ovim nalazom... Nakon analize i diskusije, naši paleontolozi se dogovore da nazovu ovu novu vrstu Eotitanops borealis.

    Zadovoljni svojim otkrićem, naši paleontolozi nastavljaju svoje iskopavanje. Prešavši na obližnji plići sloj, ubrzo nalete na mnogo veću zverku. Kosti su ogromne, životinja je bila velika otprilike kao današnji slonovi ili nilski konji. Pritom, opet se radi o nekoj vrsti koja nije preživela do danas.

    Pogledajmo njenu lobanju:




    Rekonstrukcija izleda nam daje zaista fantastičnu sliku:




    Ovde dolazi do prvog malog neslaganja. Sa kreacionističke tačke gledišta, ovo je samo još jedna vrsta koja je nestala od trenutka Stvaranja do danas. Sa stanovišta evolucije, situacija je komplikovanija. Naime, možda se radi o nepovezanoj izumrloj vrsti. Ali naš paleontolog-evolucionista primećuje mnoge sličnosti u obliku i broju kostiju, u građi vilice i nosa...sa stanovišta evolucije, vrlo je verovatno da je ova životinja daleki evolutivni rođak vrsti koju smo ranije našli, našem malom konju!


    Znači, sa tačke gledišta evolucije, on tvrdi da je moguće da su vrste evolutivno povezane, da je mali Eutitanops daleki predak ove gigantske zverke:



    Kreacionisti ovo, naravno, izgleda smešno – od tog malog konja, do ogromnog nosoroga, to ne može biti moguće. Sa stanovišta evolucije, moraju postojati prelazni fosili. Gde su oni? Imamo samo jedan veliki znak pitanja. Jaz između dve vrste je ogroman. Nakon diskusije, naši paleontolozi ostave ovu hipotezu po strani, i dogovore se da veliku zverku nazovu Brontotherium gigas.

    I, naravno, nastave da kopaju dalje. Uskoro, u jednom sloju negde između prethodna dva, nalete na još jedan nalaz! Srećni i oduševljeni, očiste kosti i urade rekonstrukciju. U trenutku kada nađu lobanju, paleontolog-evolucionista počne da skače od sreće; paleontolog-kreacionista mora da se malo namršti. Pogledajmo zašto:



    Rekonstrukcija izgleda je takođe zanimljiva:



    Slika evolucionog razvoja sada izgleda mnogo bolje. Umesto jedne velike rupe, sada imamo dva koraka:



    Paleontolog-kreacionista priznaje da postoje velike sličnosti; ali pitanje još nije rešeno. Štaviše, sada postoje dve rupe koje treba popuniti. I dalje je moguće da se radi prosto o tri vrste koje su stvorene, i onda izumrle u potopu.


    Ovde ćemo napustiti naše izmišljene paleontologe, i preći na ozbiljnu diskusiju. Fosili koji su prikazani iznad su stvarni nalazi, mada je u realnosti vrlo neverovatno da bi dvojica paleontologa uspela da naleti na tri ovako povezane vrste u okviru iste iskopine. Šta ovaj naš primer pokazuje? Ni kreacionizam ni evolucija nemaju problema kada postoji samo jedan ili dva fosila, ali kako se broj fosila povećava, tako se povećavaju problemi kreacionizma, a smanjuju problemi evolucije.

    “Ali to nije tačno,” reći će čitalac ovog teksta. “Slike lepo pokazuju neke sličnosti, ali čak i zadnja slika, na kojoj su date tri životinje, i dalje ima ogromne rupe. Ja i dalje ne verujem da je Eutitanops predak Brontoterijuma. Razlike su suviše velike!”

    Vreme je da pogledamo celokupnu sekvencu fosila:



    Kao što se može videti, ovde više nema reči o velikim skokovima i ogromnim prelazima. Razmak između A i F je ogroman, i teško je poverovati da je ogromna životinja slična nosorogu nastala razvojem male životinjke slične patuljastom konju. Međutim, ako posmatramo celu sekvencu, slika je znatno drugačija. Prelaz od A do B, ili od B do C, ili od C do D...sve do prelaza između E i F...svi ti prelazi su veoma mali, i itekako mogući. Štaviše, razlike između pojedinačnih koraka su manje nego razlike koje su ljudi veštačkom selekcijom proizveli kod, recimo, pasa. Jedina bitna razlika je što je posao izbora u slučaju evolucije obavljala prirodna selekcija, bez učešća čoveka – i na daleko većoj skali.

    U ovom uvodu, posmatrali smo razvoj Titanothera, izumrle klase srodnika današnjih kopitara. Ovakve sekvence su najčešće viđene u fosilnom zapisu: 99.9% vrsta koje su postojale kroz istoriju sveta danas postoje samo kao fosili, i svi njihovi potomci su davno nestali sa lica Zemlje. Ali najzanimljivije pitanje u vezi fosilnog zapisa je pitanje živih vrsta. Kako su one nastale? Koji procesi su ih stvorili, i kako je život došao do svih fantastičnih oblika koje danas vidimo? Ovim pitanjem ćemo se pozabaviti u sledećim poglavljima ovog teksta, korak po korak.

    Pre nego što počnemo sa time, potrebno je objasniti konvenciju za označavanje vremena, i obraditi dve najčešće greške koje ljudi prave u vezi prelaznih fosila.

  15. #30

    Odgovor: Teorija evolucije ili kreacionizma

    Označavanje “dubokog vremena”

    Kada su naučnici počeli da razotkrivaju ogromnu starost sveta i nalaze dokaze da je život postojao mnogo duže nego što je iko ikada ranije i sanjao, pojavio se jedan novi jezički problem: naučni tekstovi su svakih pet reči pominjali milione i milijarde godina, toliko učestalo da je čitanje tekstova postajalo problem.

    Zbog ovog, razvijena je konvencija označavanja starosti fosila i stena, zasnovana na metričkom sistemu. Konvencija je veoma jednostavna:
    - starost u hiljadama godina se označava slovima Ka
    - starost u milionima godina se označava slovima Ma
    - starost u milijardama godina se označava slovima Ba

    Znači, ako se za nešto tvrdi da je staro deset hiljada godina, može se reći “to je staro 10Ka. Neki fosil, recimo stromatolit, star 3200 miliona godina, može biti označen kao fosil starosti 3200Ma, ili 3.2Ba.

    Radi jednostavnosti, ovu konvenciju ćemo koristiti u ostatku ovog teksta.

    Nedostajuća veza

    Prva greška je ideja “nedostajuće veze”. Na prethodnom primeru, moguće je da će paleontolozi u budućnosti naći još dodatnih prelaznih formi iz ove grupe (recimo, lobanju koja se uklapa između tačaka C i D u našoj shemi), i da tako još više upotpune sliku evolutivnog razvoja Titanotera.

    Mnogo češće se, međutim, događa da delovi fosilnog zapisa nedostaju. Ovo je, recimo, dugo bio slučaj sa razvojem kitova: postojao je samo jedan jedini fosil koji je ličio na prelaznu formu, a čak i taj fosil je bio povezan sa kitovima samo na osnovu građe slušnog aparata.

    Kreacionisti su decenijama ukazivali na ovo kao veliku rupu u evoluciji, i izvrgavali celu nauku ruglu zato što povezuje sisare sa kitovima “pomoću kostiju uveta”. U zadnjih dvadeset godina je nađeno nekoliko drugih fosila koji su dopunili sliku razvoja kitova (kao što možete i sami videti u poglavlju 9), što je ostavilo te kreacioniste na suvom. Ali čak i da ovi fosili nisu nikada nađeni, krecionistički argument i dalje ne bi mogao da opstane.

    Zašto? Pogledajmo jedan primer.

    Do danas je nađeno toliko prelaznih fosila, i toliko je detaljno poznat prelaz između mnogih vrsta (uključujući tu čak i prelaz između Homo erektusa i Homo sapiensa u evoluciji čoveka) da je razvoj većine vrsta vrlo dobro poznat. Drugim rečima, fosilni zapis daje dokaze o evolucionom razvoju čoveka, konja, mačaka, pasa, žaba, paukova...itd, itd.

    Pritom, fosilni zapis šišmiša je, na primer, i dalje pun rupa. Paleontolozi prosto do danas nisu još našli značajne prelazne forme u razvoju šišmiša. Da li ovo znači da je evolucija propala? Ne – zato što nam rupe u fosilnom zapisu šišmiša ne daju za pravo da ignorišemo nedostatak rupa u fosilnim zapisima drugih organizama.

    Drugim rečima, kreacionista koji pokazuje na rupe u fosilnom zapisu šišmiša ne može da tvrdi da je to znak da je svet stvoren. Fosilni zapis ljudi pokazuje da su ljudi evoluirali, fosilni zapis konja pokazuje da su konji evoluirali, itd. Prema tome, kreacionista može (ako želi) da tvrdi da je Bog posebno stvorio šišmiše, dok su sva ostala živa bića evoluirala. Ili može da prihvati da se isti proces koji se desio sa svime ostalim najverovatnije desio i kod šišmiša, samo što još nismo našli fosile.

    Takođe, fosilni dokazi su samo jedan delić dokaza evolucije. Genetski dokazi, kao i fiziologija i morfologija šišmiša pokazuju njihov put razvoja, i čak omogućavaju da se sa visokom preciznošću izračuna kada su nastali i kada su se razdvojili na razne vrste koje danas nalazimo širom sveta.

    Konačno, sigurno je da je postojalo mnogo vrsta čije fosile nikada nećemo naći. Ptica dodo, čuveni izmrli simbol pokreta za očuvanje prirode, je gusto naseljavala ostrvo Mauricijus pre nego što su na njega naišli ljudi; kada je ostrvo naseljeno, ova ptica je potpuno istrebljena u roku od nekoliko decenija. Mi znamo da je ona postojala, imamo slike, kosti, i druge ostatke koje su ljudi sačuvali do danas. Ali nikada nije nađen nijedan jedini fosil ptice dodo. Fosilni zapis svih živih bića najverovatnije nikada neće biti potpun: ali i nepotpun, on potvrđuje teoriju evolucije kao objašnjenje za raznovrsnost života na Zemlji.

Strana 2 od 26 PrvaPrva 123412 ... PoslednjaPoslednja

Slične teme

  1. Jedna mala ljubavna teorija
    Autor WEISHAUPT u forumu Ljubav
    Odgovora: 47
    Poslednja poruka: 10.06.2011, 21:50
  2. Zeitgeist the movie - teorija(e) zavere ili...?
    Autor Leonard Peltier u forumu Film i pozorište
    Odgovora: 11
    Poslednja poruka: 23.07.2010, 13:39
  3. Alfa mužjak, ili teorija popišanog grma
    Autor memento u forumu Muška kafana
    Odgovora: 20
    Poslednja poruka: 27.02.2010, 16:51
  4. Teorija revolucije...
    Autor memento u forumu Filozofija
    Odgovora: 5
    Poslednja poruka: 15.02.2010, 22:16
  5. Nova teorija o tome kako su građene egipatske piramide
    Autor HLEBmaster u forumu Nauka i tehnologija
    Odgovora: 0
    Poslednja poruka: 30.06.2007, 18:21

Tagovi za ovu temu

Vaš status

  • Ne možete pokrenuti novu temu.
  • Ne možete poslati odgovor.
  • Ne možete dodati priloge
  • Ne možete prepraviti svoje poruke
  •